Alcohol, genes and human migrations... Part 1

I am Always on the look out for interesting papers that identify crucial differences between Native Americans and Asians: since Asia is the alleged homeland of Amerindians we would expect Asians and Americans to be similar, not different, so discrepancies between them are interesting (because they must be explained to justify the theory of a Beringian migration of Asians into America).

So, the other day, when I came across a map which depicted the global distribution of the ADH1B*47His allele (more on it later), I was delighted. The map, shown below, depicts a contrast between America is shaded in white and East Asia shaded dark.

Furthermore, America is similar to Subequatorial Africa, Western and Northern Europe and the Arctic region of Central Siberia, and very different from Asia, PNG and Australia. [1]

Global contour plot of ADH1B*47His Allele. From Fig. 2 in [1]

So as clear as Black and White, America (white) is different to Asia (Black). Something is going on. Apparently America, Europe and Africa share a common trait not found in the rest of Eurasia and Oceania. This is indeed another case of an Amerindian gene not shared by their alleged Siberian or Asian "relatives".

I decided to take a deep look into the matter. And first of all, find out what was this ADH1B*47His Allele is all about... and the story is quite interesting.

On food, alcohol and genes

Fruit is a primary source of energy for many insects and animals, including our primate ancestors. Overripe fruits, in a warm and humid tropical environment can ferment and attain a considerable level of alcohol (even as high as 8.1% - about half way between wine and beer), this is quite intoxicating and has evolutionary implications.

Monkeys eating this kind of fruit would get drunk and unless they developed some mechanism to get rid of the alcohol, would face serious problems in the wilderness: a tottering and drunk or even a hung-over ape would be an easy prey for a sober lion or leopard.

Since our hominid ancestors also ate a considerable quantity of fruit, they too would have had to deal with alcohol in their systems. Somehow they would have to cope with optimizing the fruit as a food resource, with the alcoholic consequences of its ingestion: Alcohol metabolization is something that over the course of thousands of years would selected for, or against, by the forces natural selection.

It appears that the common ancestor of both humans and chimpanzees developed the ability to metabolize alcohol about 10 mya [2]. We still carry this adaptation in our genes. But not all humans have the same set, there are differences, and their effects are noticeable.

About metabolizing alcohol

The alcohol we ingest is absorbed into our blood stream and besides giving us an "alcoholic high", it goes through our liver which breaks it down into other compounds.

There are two kinds of enzymes that metabolize alcohol: ADH, or Alcohol Dehydrogenase and ALDH or Aldehyde Dehydrogenase. They work in tandem to rid us of alcohol:

ADH tuns ethanol (ethyl alcohol) into acetaldehyde, a nasty toxic substance which which provokes nausea, hedaches, hangover and flushing. The aldehyde in turn is metabolized by ALDH into acetic acid (actually, acetate, the ion) which is finally eliminated as waste.

The reactions are the following:

H₃C - CH₂-OH (ethanol) -- ( ADH ) --> H₃C - CH=O (acetaldehyde)

H₃C - CH=O (acetaldehyde) -- ( ALDH ) --> H₃C - COOH (acetic acid)

The interesting part of this is that there are different alleles of the genes that code for these enzymes, and that these are found at different frequencies among human populations around the world (like shown in the maps above and below).

ALDH alleles and aldehyde

It appears that people who carry a mutated allele of ALDH2*2 gene, the ALDH2*487Lys, are less likely to become alcoholics (Huai-Rong, Luo et al, 2009) [3], and the reason is very straightforward: the mutation reduces the enzyme's ability to convert acetaldehyde into acetic acid, therefore acetaldehyde accumulates in the body, dilates capillaries provoking a flush, and other negative hang-over consequences such as headaches and nausea. Since drinking becomes unpleasant, the carriers of this mutation tend to avoid drinking and remain sober.

Other people, lacking this mutation, turn aldehyde into acetic acid more efficiently, so drinking, for them, is pleasant, which increases the risk of alcoholism.

It appears too, that the "deficiency allele is of interest because natural selection in the form of conferring resistance to parasite infection may have preserved this allele in Asia" [4], so besides keeping its carriers sober, it kept them healthy too. This would also be something that natural selection processes could act upon, reinforcing the presence of this allele.

This ALDH2*2 mutation is predominant among people of East Asian descent. (between 26 and 46% of Chinese, Japanese and Koreans carry it), it falls to 13-6% in the surrounding areas and to less than 3% in India, Europe and Papua New Guinea; it is absent among Native Americans. So we can guess that the latter populations will tend to be more alcoholic than the former.

Map showing the global distribution of ALDH2* alleles. The red segments indicate the "Asian" mutation. Adapted from [3]

The paper (Huai-Rong, Luo et al, 2009) [3], contends that the "limited distribution of atypical allele ALDH2*487Lys indicated a recent expansion event."; and they believe that it originated recently in the Pai-Yuei tribe in Southern China 2 to 3 kya., maybe because they cultivated rice. Which may be the case. They do not present any proof regarding their dating, so I will take it as an educated guess.

The interesting part is the following:

The weight of the "other" alleles in America also differ from those in Asia:

There is no GCCTA or "Asian allele" (shaded red in the map) in America (or elsewhere). This is exclusively Southern and Eastern Asian.

The ATCTG type (shaded pale violet in the map) is predominant in Central and Southern America (45 - 90%) whose average is the same as that of Europe (66.8%). It drops off in the rest of the world: South West Asia (47.3%) and PNG (45%), and is lowest in Africa (3%) [5].

It is also found in low frequencies in North America (avg. 33%), and Northern Asia (less than 25%, in Siberia: 13%). It is even lower in East Asia (4.9%). [5] The fact that it has a global distribution points at an ancient origin, and being present in Africa at such low frequencies, indicates, in my opinion, that it probably back-migrated into Africa after originating out of Africa somewhere from where it dispersed globally (the Middle East?).

However (Oota et al., 2004)[5] despite being the most common global haplotype, it is recent. They give two reasons:

1. "The HaeIIIc site [which defines this allele ATCTG] is not polymorphic in five sub-Saharan Africans [...] The results indicate the HaeIIIc site [is] relatively young polymorphism.". This is so, despite the fact that " the ages of the other polymorphic sites we examined are as old as modern humans’ expansion" [5]
2. The inferred evolution of this allele (ancestral --> ACCTG --> ATCTG) or sequential pattern of mutations also indicates that the HaeIIIc polymorphism is relatively young". Oota et al., argue that it is two mutations away from the ancestral form and therefore young. But, so is the GCTCG allele (pale blue on map) yet they belive that it is as old as modern human expansion.

There is also the ancestral lineage, which in Asia and Africa accounts for 33 - 55% of alleles but is virtually absent in Europe and Southwest Asia (1.4% and 7.2%, respectively) yet it is present in America at frequencies of 5 - 33% (lower in South America, higher in North America). It is, in general quite common (10.0%– 53.9%) elsewhere. [3][5].

The GCTCG (pale blue in the map) haplotype is "ubiquitously distributed, it would appear to have arisen in Africa and drifted to an appreciable frequency prior to the expansion of modern humans out of Africa" [5]. This too is two mutations away from the ancestral version and there are two possible variants, involving two rare alleles:
ancestral --> GCTTG (found among the Han Chinese) --> GCTCG
ancestral --> GCCCG(found among the Ugyurs) --> GCTCG

Despite being two mutations away from the ancestral line, it is deemd as ancient! While the "Asian" allele, (red in map) GCCTA supposedly only one mutation away from the ancestral allele is deemed to be recent!.

STRP D12S1344 and some genetic theory

Oota et al., 2004) [5] dug deeper in the geographic variation of these alleles. They included the short tandem repeat polymorphism (STRP) STRP D12S1344 and graphed the distribution of the 5-SNP haplotypes (the ones mentioned above: GCCTG, CGTCG, ACCTG, ATCTG, GCCTA) according to the STRP's alleles.

Let me explain this first (It took me some time to understand what they did and its implications), below is some theory.

STRP stands for Short Tandem Repeat Polymorphism.

The DNA sequence of different people varies in some parts of our chromosomes. These variations are known as "Polymorphisms". There are some special kinds of polymorphisms known as "Short Tandem Repeats", which are interesting for the study of genetics, so the study of these STRPs is important.

Four nucleotides: guanine (G), adenine (A), thymine (T), and cytosine (C) make up the nucleic acid of DNA.

STRPs are relatively short sequences of DNA (hence the "Short" part of the name"), comprising between 2 and 5 base pairs that are repeated (hence the "Repeat" part of the name) one after the other in "Tandem". The result is a sequence of the repeated unit. In the case of STRP D12S1344, the repeat is a two base pair (therefore, a dinucleotide), "CA" (cytosine and adenine) which is repeated n times. For instance: "CACACACACA" is a 10 bp sequence of a 5 tandem repeat of the dinucleotide "CA".

Since different individuals carry different repeat numbers, these are "polymorphisms" that differentiate one person from the next: for instance: One individual may have 5 repeats, the other 6, and yet another 8. These repeats arose from mutations in their ancestors.

STRs are usually considered “junk DNA” because they are introns and do not code for protein, changes in them do not affect the people carrying them. They are neutral to the forces of natural selection.

In the case of our STRP D12S1344, it was chosen because it is downstream of the ALDH2 gene locus. This STRP was "typed" (that is, it was sequenced) and its repeats were found to vary between 11 and 25 among all humans. These represent different polymorphisms. And each different repeat value indicates a different allele. These were given names: for repeats n=11 the allele was named "allele 222", n=12 was named "allele 224" and so on, until n=25 which was named "allele 250". [7]

By "repeat" we mean exactly that; so in allele 222, the "CA" dinucleotide is repeated eleven times. Below we see the eleven repeats flanked by the remaining sequence common to all humans:

... TCGTTTTCTGGGATACACACACACACACACACACACA TTCTGTCCTTCTTTT...

What causes the appearance of different polymorphisms in a given population? (Why does Joe have n=14, Jane have n=22 and Wang have n=15?).

They arise due to chance mutations that happen at a very low rates: between 1:100 and 1:1,000,000 per generation. [6]

They are mostly formed due to "replication slippage", whereby the DNA strands are mismatched during DNA replication and a repeat is added (or removed) from the resulting duplicate.

Since slippage is a symmetrical process, repeats are added and also removed. The outcome is that new alleles with a higher number of repeats are added and others are lost by removal.

Nevertheless, they are, in general, conserved over long evolutionary time spans and it seems that long repeats tend to shorten while short ones lengthen [6] even though insertions might tend to be self-accelerating and grow as the probability of a future mispairing increases.

Since natural selection operates on other parts of our DNA (those that code proteins), but not on the "junk DNA " of STRPs, the origin and evolution of different frequencies of repeats is due to chances (which adds or removes repeats), also to selection operating on the coding part of DNA and finally from the admixture with other populations having a different repeat mix in their genes.

We can imagine a group of people sharing a certain coding DNA due to their common ancestry and also the same repeat in an STRP. Should selection select against or for the trait coded by that DNA, then the STRP would be favored or disadvantaged because it shares the fate of the evolutionary pressures on the DNA it is piggy-backing on.

So there are three factors that interplay in the repeat alleles: chance, selection and admixture.

STRP D12S1344 continued

When comparing the STRP among different human groups, Oota et al., (2004) [5] found the following distribution of alleles (remember, the x axis indicates the number of repeats 222 is n=11 and 250 is n=25). The color depicts the relative frequencies of the 5-SNP haplotypes (the ones mentioned above: GCCTG, CGTCG, ACCTG, ATCTG, GCCTA) for each repeat allele. The number beside each region is the amount of populations sampled (yes, South America is always under-sampled, only three populations were considered: Karitiana, Surui and Ticuna [7]):

ALDH-2 5-SNP haplotypes of each repeat Allele at STRP D12S1344. Adapted from Fig. 4 Oota et al., [5]

So, what does it mean?

Let's take a look at it with a regional perspective:

• Africa, as expected, has a predominance of the Ancestral alleles (in black). The frequency histogram has a bimodal distribution with two clusters, one between 226 and 230, the other from 234 to 250. With the highest values at 238 and 240. In total, 12 alleles.
  There is a touch of GCTCG (pale blue) and similar amount of ACCTG (green), both widely spread.
  No "Asian" GCCTA (red), a clear indication of its East Asian origin.
  Very little ATCTG, (violet), at allele 236.
• Following the imagined tracks of an Out of Africa migration, we can see the shared traits of both South Western Asia (it has 11 alleles) and Europe (ten alleles), which are the closest to Africa.
  We see, with surpirse how the ancestral (black) lineage is virtually gone.
  The prevalence of ATCTG (violet), in contrast with Africa, and a similar content of GCTCG or (Blue). ACCTG (green) is also similar to Africa.
  The prevalence of repeat 240 has decreased and repeat 236 has grown to a similar frequency as 240. While the second "peak" at 226-230 is still there.
• East Asia, with is peculiar mutation, maintains a very high proportion of the ancestral lineage, though it has lost some longer repeats (246 to 250). It kept the second the peak at 226-230.
  It also mantains a predominance of the 240 and 238 repeat like Africa, and it is there that the GCCTA, Asian mutation (in red) appears.
  Repeat 240 reached a +50% frequency, fifty percent higher than the 30% frequency of this repeat found in other regions. Nine alleles are found in this region.
• Siberia. Not graphed by Oota. The Siberian Yakut, [7] are quite unlike the North and South American natives: they have a maximum of 42.2% at repeat 226. The highest in the World for this allele. Are these the ancestors of the Amerindians? It seems unlikely
• North America. The histogram shifts to the right: 242 and 244 repeats grow considerably:15% frequency at 244. The second "peak" at 226-230 still appears.
  The ATCTG, (violet) allele is found in much higer frequencies than in East Asia or Africa, but lowe than S.W. Asia and Europe. And the ancestral allele is also found at high frequencies, higher than S.W. Asia and Europe, but lower than East Asia or Africa. There are 9 alleles in this region.
• South America. The "second peak" has disappeared (226-230 repeats). And also, there is an increase of higer repeat frequencies, even more than those found in North America: there is a peak at repeat 244 of 25%, highest globally (mostly ATCTG - violet), and also at 238 with 20%, also a global high.
  The ancestral (black) allele is lower than N. America, East Asia and Africa. Only 7 alleles are present in this region.
  South America has the "two pronged" high frequencies on the right side of the histogram, just like Europe and S.W. Asia. All other regions have only one maximum on the right side.

Neanderthal admixture?

Since non-Africans admixed with Neanderthals, you might expect that the characteristic alleles of Neanderthals would appear in humans. I have not found any paper regarding this to be able to quantify it.

Nevertheless, the signal should be there. The sharp difference between European and S.W. Asian alleles on one side and the Asian, African and North American on the other is noticeable. The former have a one prong maximum at 240 while the latter have a two prong maximum in that area.

To me this spells "Admixture": mixing of two populations makes certain frequencies grow: those in which both populations overlap will grow, where no overlap exists, the frequency will decline. The exact amounts depend on the histograms of each population and the admixture ratio. I will do some simple simulations in part 2 of this post.

The double prong maxima is basically made up of ATCTG, the violet color mallele. Could this be a Neanderthal allele?

The Native Americans in South America have lost part of their alleles (the second peak centered on 226): perhaps due to a bottleneck in the population as it moved into South America, or maybe even later, 500 years BP, during the conquest, when millions of natives died due to disease brought by the European conquerors.

The alleles that did survive were those shared with Europeans (ATCTG, violet) -which may even be of Neanderthal origin- perhaps because they were related to coding areas common to Europeans and therefore granting protection against disease brought by them to America.

At repeat 240, compared to North America, the ancestral allele decreased at the expense of a growth in the ATCTG - violet one.

ACCTG (green) also survived, in lower frequencies than in North America and, again, at those frequencies common to Europeans: 236 to 242.

I wonder what would the DNA sequences of prehispanic natives show? Was the repeat diversity richer? Did they (and in this I include North American Natives), have a wider dispersion? Other haplotypes now extinct?

Continued in Part 2...

Sources

[1] Hui Li, et al., (2007). Geographically Separate Increases in the Frequency of the Derived ADH1B*47His Allele in Eastern and Western Asia. Am. J. Hum. Genet. 2007;81:842–846. DOI: 10.1086/521201
[2] Carrigan, M. A., et al., (2012). The Natural History of Class I Primate Alcohol Dehydrogenases Includes Gene Duplication, Gene Loss, and Gene Conversion. 7, s.l. : PLoS ONE, 2012, Vol. 7.
[3] Huai-Rong Luo, (2009). Origin and dispersal of atypical aldehyde dehydrogenase ALDH2*487Lys. Gene 435 (2009) 96–103
[4] Raymond J. Peterson, David Goldman and Jeffrey C. Long, (1999). Effects of Worldwide Population Subdivision on ALDH2 Linkage Disequilibrium. doi:10.1101/gr.9.9.844 Genome Res. 1999. 9: 844-852
[5] Oota,H., Pakstis, A.J., Bonne-Tamir, B.,Goldman,D., Grigorenko, E., Kajuna, S.L., Karoma,N.J., Kungulilo, S., Lu, R.B.,Odunsi, K.,Okonofua, F., Zhukova,O.V., Kidd, J.R., Kidd, K.K., (2004). The evolution and population genetics of the ALDH2 locus: random genetic drift, selection, and low levels of recombination. Ann. Hum. Genet. 68, 93–109. doi: 10.1046/j.1529-8817.2003.00060.x
[6] Christian Schlötterer, (2000). Evolutionary dynamics of microsatellite DNA. Chromosoma, September 2000, Volume 109, Issue 6, pp 365-371
[7] The allele frequency database ALFRED

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall © 

More on the Caaiguá wild men

My recent post on the Caaiguá people, wild men, left me a bit intrigued, so I did some more research and came across the original texts written by contemporary witnesses: Jesuit priests from the Missions in the jungles close to where these people lived.

The Jesuits's written accounts show that these people were quite singular:

• They spoke a language that was quite different from the Guaraní language spoken by the surrounding tribes.
• It had a "whistling" like sound
• The Caaiguá lived in caves and were stone-age hunter gatherers
• They were described as similar to both apes and men and with limited intellectual capabilities
• They were also very belicose and violent

I am inclined to believe that they were indeed a relict Neanderthal group, human yet not human enough, feature that led both natives and missionaries to consider them authentic wild men.

Wild Men in detail

Father Lorenzo Hervás y Panduro, wrote several learned books on the native languages of North and South America, and, as could be expected, mentioned the language spoken by the Caaiguas. I quote him below (the bold font is mine):

"The Caaiguá Language.
The Caaiguá language is spoken by the nation of the same name that has settled to the east of the Uruguay River to the north, near its sources [Shaded in red in map below] it is a peculiar language of rough and difficult pronounciation as Techo correctly notes, and speaks about the Caaiguá tongue as follows: 'The Caaiguás use their own language which is hard to understand because when they pronounce the words they do not seem to speak but instead whistle or form unintelligible tones in their throats'.
The name Caaiguás is Guaraní and means wild and because the converted and civilized Guaraní usually give the name of caaiguá to some Guaraní tribes that wander about in the jungle, some authors have believed that the Caaiguá is a Guaraní dialect and have mistaken the true Caaiguás for the nomad Guaraní tribes..." [1]

This is very interesting, it clearly points out that these people are not Guaraní. That the also name applies to ethnic Guaraní people who live under their pre-hispanic conditions, in the jungle. But that the real Caaiguá people are a distinct group with their own peculiar language.

And a very strange language indeed, with whistling sounds!. I looked up the text written by father Techo, which Hervás y Panduro quoted, and it proved to be very interesting too:

Nicolás del Techo's text

He was born in Lille in 1611 as "du Toict" (which he modified to a Spanish version: "del Techo"), and died at the Mission in Apóstoles in 1687. He became a Jesuit in 1619 and came to America in 1640 working as a missionary, and historian in South America.

This text was published in Antwerp in 1654 as the "Relatio triplex de rebus indicis". It was a letter that he wrote in 1651 at the Mission of Santa María La Mayor, on the Uruguay River in the Missions of Paraguay.

Map showing the probable territory of the Caaiguás and the Jesuit Missions
Copyright © 2014 by Austin Whittall

The mission is located in Argentina, in the province of Misiones, Santa María municipality. It was founded in 1626 and abandoned in 1767. It is a UNESCO World Heritage Site and has been restored.

Below I quote the intersting parts of the text (bold font is mine):

"We are taking care of here, the two of us, of two thousand six hundred indians [...] To this task we add another, not less difficult: the taming of the most ferocious Caaiguá people. [...]
The Caaiguá people are not very numerous and are the less apt for work among all the indians. They live in the jungles between the Paraná and Iguazú rivers [Shaded in Yellow in the map below] , and for this reason the surrounding tribes call them jungle inhabitants (which is the meaning of the name Caaiguá). They speak their own language, not very easy to learn, because, they when they issue their sounds, it seems that, instead of speaking, they whistled, producing a whirlwind of inaticulate explosions in their throats.
They have very few huts and these are very far apart. Most of these indians are happy living in hovels, like animals, and do not procure their food any better than them, so they do not practice agriculture or have any farming activities. The fish and hunt with bow and arrow. Nevertheless, most of the year they eat raw worms, mice, ants and other small creaturs that they can catch easily. The fight with tapirs [...] they kil them and eat them; climbing up trees they catch monkeys with such dextrity, as if they themselves were apes. They like monkey meat a lot and eat jaguar meat without flinching [...] They are physically deformed and are monstrous, similar to both monkeys and men, especially if you look at their noses, which allows you to fairly call them stub-nosed. As they live in the jungles most of them have their backs bent and hunched, making their gaze remain fixed towards the ground. They walk in a bent over manner. However many of them have a nicer appearance, especially the women, who born and bred in the shade keep the color of their body quite similar to that of Europeans." [2]

He also mentions that they were wild and fierce, muderding anyone who dared to go into their territory, that the Guaraní killed them whenever they could. And that when captured they were "difficult to tame [...] refused food and died in a few days". A missionary, Father Claudio brought up a Caaiguá boy and taught him the Guaraní language so that he could be an interpreter for him (a clear indication that Guaraní and Caaiguá spoke distinct languages) and went to their territory to convert them, enticing some to come down to the mission:

"So some of them came out of their caves and [...] canme to the town of Santa María La Mayor.[2]

They did this again and: "After a journey of nine days this illustious hunter of souls went into the caves of the wild men and through his interpreter managed to get eighteen of them to agree to be converted and follow him [...] he found the inept to retain and obtuse to undestand clearly." [2]

The Jesuits fought against a slaver raid by the Brazilian Mamelucos and freed several Caaiguá natives, earning their gratitude.

The Brazilians hunted natives to capture them and sell them as slaves. This decimated the native tribes of what is now Southern Brazil, Paraguay and the Argentine provinces of Misiones and Corrientes. The Jesuits organized armies to fight them off, but when the Spanish cronw expelled the Jesuit Order from America, their missions quickly dissolved and became ghost-towns, swallowed up by the jungle. The natives disbanded and returned to their old customs.

The region remained forgotten during the independence and civil wars of the early XIX century. It returned to the limelight during the war between Paraguay and Brazil, Uruguay and Argentina in the 1860s and its borders were drawn up during the late 1800s. At that time Argentine explorers such as Ambrosetti and Lista visited the region (which was part of a border dispute between Brazil and Argentina). Both of them mistook the ethnic "wild" Guaraní people for the original Caaiguá people.

Juan Ambrosetti (1886) called them Kaingangues, Caigua, Caingua and Ramón Lista (1883) Caayguás, but these were not the real Caaiguá mentioned by del Techo, who had probably already become extinct due to the slaving raids of the late 1700s.

Sources

[1] Lorenzo Hervás y Panduro, (1800). Catálogo De Las Lenguas De Las Naciones Conocidas, Y Numeracion, Division, Y Clases De Estas Segun La Diversidad De Sus Idiomas Y Dialectos: Lenguas Y Naciones Americanas. Rank, Vol 1. pp 296.
[2] Nicolás del Techo, (1654) Relación Sobre la Gente Caaigua que se empezó a convertir. Republished by Arturo Nagy & Francisco Pérez Maricevich, (1967), Tres Encuentros Con América. Ed. del Centenario, Asunción.

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall © 

More on Elongated skulls in America...

On red or fair haired elongated skulled people in Peru. Artificial and naturally ocurring skull deformation...

WWe know that cranial deformation is widespread across the globe, [9] and that American natives did it at the time of Spanish discovery and conquest.

The map below from Juan R. Munizaga (1987) Deformación craneana intencional en América, clearly shows that it was widespread and very ancient practice: [8]

Munizaga, author of the map, points out in his work [8] a very unusual hypothesis that:

"in only two of the cases can we be reasonably be sure of an extra-American origin: a) The annular, oblique tabular and erect tabular types found among the people of the Northwest coast of North America [...] which entered our continent very few centuries ago [...] and b) the brifronto-vertico-occipital deformation. This type, is very rare and exclusively found in Southeastern USA [...] is depicted in ceramic figures of a Taoist monastery in China dating from the early Christian Era [...] accepting an extra-American origin, we propose a general hypothesis that this custom was introduced by travellers from the Far East..." [8].

Nevertheless, I want to point out a comment published in 1855 by Rivero regarding deformed crania as a mutation and not due to artificial causes: [1]

Oblong skulls were due to a mutation

"there is more: the same configuration is found among unborn children and we have become convinced of this truth after seeing the fetus found in the womb of a pregnant woman's mummy, which we found in a cave in Huichay, two leagues from Tarma and which is now in our collection. Professonr d'Outrepont, one of the leading celebrities in the science of obstertrics has assured us that this fetus is seven months old. It belongs, according to the very pronounced configuration of its skull, to the tribe of the Huancas. In plate VII of the Atlas is this interesting and decissive proof against those favoring mechanical action as the only and exclusive cause of the phrenologic shape of the peruvian race... [1]"

The image below depicts the fetus mentioned by Rivero above:

Plate VII. Rivero (1855). Seven month fetus with elongated skull. From [1]

Although one case is not enough to support a mutation that produces elongated skulls, and we could also assume that the fetus described by Rivero had suffered some intra-uterine disease that caused that oddly shaped skull.

Nordenskjöld reported that a baby was born in Bolivia with an unnaturally long head, but the midwife was not worried, they could shape it at will and make it rounder ("In Ascencion wurde ein Kind mit unnatürlich langem Kopfe geboren" = "In Ascencion a child was long with unnatural Head born".[5]

The above shows two things: (1) oblong skulls ocurr naturally and (2) Amerindians were good at re-shaping skulls.

Nevertheless, Rivero's opinon was repeated later by : " A. L. Kroeber (1944), reporting on pre-Inca crania from further north on the same coast, stated that the majority of undeformed Early Chimu skulls were long. Thus, these earliest pyramid builders of Peru were not identical with their historic successors, all of whom are round-headed... " [2]

Since I am not a specialist I can hardly judge how Kroeber detected that ancient Early Chimu skulls were "long". But if his research was sound, it could point out to some genetic trait.

If it has a genetic cause, perhaps DNA sequencing could shed some light on the matter (and I mean "real" sequencing, and not the kind I posted about yesterday).

The Paracas mummies had elongated skulls (in my opinion, artificially elongated skulls), and possessed oddly colored hair:

Light colored Amerindian hair

Mildred Trotter examined the hair from the Paracas Mummies, and described it as: "... the sample in each case was interspersed with very light yellow hairs which may be assumed to have been white. In general, the color was a rusty brown and gave the appearance of having faded..." [3]

She also noted that the hair of two of the mummies "was quite definitely wavy" and was straight in the others. Waviness is related to the hair's shape of its cross-section. Amerindian and Asian hair tends to have a circular cross-section (straight hair) while Caucasian hair is more oval (tending to be wavy). Trotter reported that "The cross-section form shows so much divergence between the different mummies that they cover all divisions of hair form" [3], that is Amerindian - Asian - European.

The area of the cross-section of Paracas mummies was 30% less than the average value for Amerindians. (European cross-section surface is smaller than Native American surface area): "The size of the hair was much smaller than has been found for other Indians..." [3]

Realizing that this may place the Paracas people outside of the Amerindians, she added that post-mortem dehydration could account for changes in cross-sectional shape as well as its surface area. The brown or reddish colored hair could also be the consequence of a dark black hair having faded over time. The fair hair was due to a darkening white hair.

Trotter's explanations are very reasonable and is the most likely cause for odd colored hair among the Paracas people.

However, reddish wavy hair is not unknown among the Mataco natives from Argentina's Chaco region (northeastern Argentina), see Pelleschi below: [7]

"The hair is straight, but in some -very few- individuals I have noticed it slightly wavy, almost curly, I can not say if due to art or nature [...] The hair is jet black among the adults, white among the elders [...] reddish often among the boys until the age of 10 or 12 years: a curious thing, which brings to my memory Salles theory, according to which primitive men must have had red hair. So here we would have a case of atavism..."[7]

We can forgive Pelleschi for his Victorian mentality (after all, he wrote that in 1897).

I am always interested in red-haired people outside of Europe because it may indicate a link to Neanderthal genes, and if in America, it may hint at an early migration of Neanderthals into America followed by admixture there with Homo sapiens, once they reached that continent.

A closing word on Deformed skulls

Cieza de León, a Spanish conquistador and chronicler noted that along the coast of Ecuador (in the 1540s), the newborn baby's head was pressed between two boards (tablas) so that by the time he reached the age of four or five his head was either long or broad. They did this because it made them healthier and better able to work. [4]

Curiously, another reason is given for the practice of cranial deformation: Dr. Alvarado cites Juan Manuel Balcazar and his book about "The History of Medicine in Bolvia" where he states that according to Pachacutec: "The Inca [emperor] Manco Kapac decreed that the head of newborn babies be tied so that they grow up with mental handicaps because indians with large round heads were very enterprising and specially very disobedient". He wanted them to have long sloping heads to make them obedient and submissive.[6]

Many Paracas skulls have holes neatly cut into them, these trepanations are be explained by Dr. Alvarado:

Skull deformation caused plenty of problems according to Dr. Alvarado. It led to intra-craneal hypertension which can be noted due to the presence of the so called digital impressions seen on some of the deformed skulls. This custom led to mental alterations, reduced IQ, epileptic fits, head aches, etc. And (this is very interesting) may have been the reason that some of the skulls were trepanated, that is, opened, as a kind of cure (perhaps to let the "demons" of illness out). Though some alien-mongers suggest hi-tech medicine was required for these skull opening operatins, they were done under primitive conditions with obsidian tools, and the surprising fact is that up to 60% of the patients survived the operation. [6]

Based on all of the above, it is quite weird to suggest that the Paracas people had a mtDNA unlike any other human one, displaying mutations not found in any animal (see yesterday's post please). The Paracas mummies were normal humans with artificially deformed skulls. The light color of their mummies hair may be due to some genetic trait or, simply the aging of ancient hair which bleached it. There was probably some genetic mutation that caused occasional oblong heads among Amerindians as reported by Rivero, Kroeber and Nordenskjöld, but its prevalence among the native Americans is unknown.

Sources

[1] Mariano Eduardo de Rivero, (1855) Antigüedades Peruanas. pp 32
[2] Thor Heyerdahl and Geoffrey Ashe, (1971). Isolationist Or Diffusionist?: The Bearded Gods Speak Pall Mall press.
[3] Mildred Trotter, (1943). Hair from Paracas Indian Mummies. Am. J. Phyg. Anthrop., n.s., 1 (1) : 69-76.
[4] Cieza de León, P., Ballesteros, M., [Ed.], (2000). La crónica del Perú (1553). Madrid:Dastin S. pp. 177
[5] Nordenskjöld, E., (1910). Indianer und Weisse in Nordostbolivien p. 153
[6] Dr. Ramiro Alvarado. Trepanaciones y Deformaciones Craneales en Tiwanaku, Sociedad Boliviana de Cirugía
[7] Pelleschi, Juan, (1897). Los Indios Matacos y su Lengua. Part I. Ch. II. pp 175

Further Reading

[8] Juan R. Munizaga (1987). Deformación craneana intencional en América. Revista Chilena de Antropología No 6. 1987, 113-147.

[9] Dingwall, Eric, (1931). Artificial Cranial Deformation London.

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall © 

Ukumar and bears or Homo erectus?

I have already written about the "Yeti" in the southern parts of South America , (Jan 18, 2011), but I will go over this subject again since several cryptozoology blogs and books [2] mention hairy ape-like men in the High Andes and some cite an event reported in the Puna region in Salta, Argentina, in 1956, at the small village of Tolar Grande (try googling "tolar grande 1956 sighting" and see the results).

Yeti and the media

The context is always important when you look at repeated reports of similar phenomena in a given period of time (for instance witches in the middle ages, UFOs in the 1950s and 60s).

The Yeti burst into the public eye and mind in the early 1950s: footprints were reported by Eric Shipton in 1951, and the team that were the first to conquer the summit of Mount Everst, Edmund Hillary and Tenzing Norgay also reported them on the first ascent of Mount Everest in 1953. [1]. Later, in 1954 an expedition was sent to find one alive, funded by the English newspaper, the Daily Mail.

So it is not surprising that the Yeti was something that would crop up when strange hairy mountain beings were reported in the fifties. Also, the early 1950s was a period when UFOs began gaining public attention and newspapers published sightings weekly.

Cerro Macón

Cerro Macón (5.611 m - 18,396 ft.) also known as Icomán is a mountain located in the Province of Salta in northwestern Argentina (24° 27' S, 67° 15'W) it is part of the Cumbres del Macón Range of the Andes Mountains.

It is located in between the enormous salt flats of Pocitos and Arizaro and juts out above the surrounding extremely high Puna plateau which in this area is about 4,100 m high (13,440 ft.); it is an ancient sacred site for the local native Americans.

On its summit, there is a mound of stones 1.4 m (roughly 5 ft.) high, where the local natives leave their offerings (coca leaves, cigarettes) as well as two rectangular platforms 0.8 m (nearly 3 ft.) above ground level, these were evidently built during the period of Inca domination in the late fifteenth Century AD.[3]

The following map shows the location of Cerro Macón in the Puna, Salta province, Argentina. The village of Tolar Grande is at the tip of Route "27" and is set at 3.528 m (11,567 ft.) above sea level. It has only 148 inhabitants and was built in a lonely spot next to the railway station of the Salta - Antofagasta railroad.

Ver mapa más grande

The events of the mid 1950s

Below is a summary of what happened in the mid 1950s, I have found an interesting website [4] which has posted the actual cuttings from a local newspaper. I have translated the relevant parts.

• July 17, 1956. The "El Tribuno" daily, of Salta city, reported that people had seen, close to Macón Mountain, "enormous human foot prints that are bigger than the size of those of elephants", it added that cigar shaped aircraft had been seen in the Puna skies as well as a "mysterious crash reported on the slopes of Cerro Macón, of which nothing else has been heard about to date". In other words, a Roswell accident in the Puna!
• July 18, 1956. Same newspaper. An engineer by the name of "Audio Level Pitch" (odd indeed, sounds like an electronic device) saw "tracks going towards the imposing summit of the mountain, which are of a formidable size and that by logic deduction cannot belong to a human being or the animals of the region [...] the tracks are very similar to those of the "abominable snow man". The 50's context: Yetis and UFOs in one story. A newspaper seller!
• July 19, 1956, Same source. The witness' name changed to "Claudio Level Spitch" . The tracks were spotted in the "cold sand and snow" , and are similar to those of the Yeti, but, must be of extraterrestrial origin since there was a "crash on the slopes of the Macón Mountain"
• July 27, 1956. El Tribuno. A man named Ciriaco Taritolay, an animal driver from the Escoipe Canyon area (south of El Tolar Grande, and an access to the southern part of the Puna. Map of this area), saw at the entrance of the "Agua Chulla" Canyon, a "supernatural being", the man "remembered the descriptions he had read in EL TRIBUNO about the Yeti Man and thought that it may be Snow Man" , bearing this in mind he chased the creature with his shot gun but it quickly got lost in the hills. He described it as follows: "Tall, sturdy, its body covered with hair resembling frost, its feet 45 to 50 cm (18 - 20 in.), and very agile".

Comments on these incidents

The odd name of the source, Audio Level Pitch, loudly says "hoax". So I belive it was made up by some bored reporter at the El Tribuno. UFOs and Yeti were hot eye-catchers at the time, so it would have tempted someone to write about them.

The final article though it actually confirms that the eye witness read about the Yeti in the EL TRIBUNO!, points towards another local mythical being a hairy ape man, or, more correctly, the "bear-man".

The Ucumar

I will skip all the more recent authors who cite this book which I will mention below, and all the websites that copy and paste. I will go directly to the source, a treatise on Argentine popular myths written by Dr. Berta Elena Vidal de Battini, an anthropologist and sociologist who gathered local lore from direct sources all across the country, in the 1950s, tales, myths and popular stories which she published in her ten volume work "Cuentos y leyendas populares de la Argentina" (see sources below where you can read the digital book). [5]

Dr. Vidal de Battini specifically mentions the Ucumar in the stories she compiled (#2304 to #2310), the date is given at the end of each entry; all are in the early 1950s:

• "The Ucumar is like a bear, like a bear-man. They say that it lives in places deep within the canyons, in the caves in the cliffs. They say he is stubby and has a pot belly. He has a long beard and his feet and legs like those of bears... the Ucumar steals women and takes them to live with him and he also nabs children. They say he has small but bright eyes. There are many cases in which the Ucumar has stolen women and had children with them. They say that after some time the wife and child run away from the Ucman and come to live with the woman's family". 1953. Salta.
  Comment. Notice how he compares it with a bear but calls him bear-man, who can mate and have offspring with humans.
• "The Ucumar is an animal thal looks like a man, its body is completely covered with long black hair. It lives in the forest in uninhabited areas. The people fear it...". 1950.
  Comment. This person also mentions that it kidnaps women.
• Calling it Ucumar: "On some nights, screams could be heard at the tops of the hills... [a man, in the forest stopped to drink at a stream and heard his dogs bark] he saw a being that resembled a man with long hair that covered his face, which he lifted to be able to see... he had the aspect of a hairy, long haired man". 1952
• Calling it Ucumari: "it is a creature like a big man, that always goes about on two feet. The arms and legs are hairy or woolly and the face is very similar to that of a person". 1952. The story teller reports that it also steals women to have children with them.
• Calling it Ucumare: "it is a small man, with his body covered with hair and his feet turned backwards... it is a monster-man, with extraordinary strength. The Colla women have told that they have had to fight with them to avoid being carried off whenever they come across one. They say that he has stealed women, taken them to the forest and that they have never returned" . 1958.
• "Ucumar is a ugly creature that takes off people. If it is a male it will steal women; if it is a female it will take of the youths... Once a Ucumar female took a young man with her to the deepest jungle and put him in a cave, blocking the entrance with a stone. After some years she had a baby with the man." 1952.

Dr. Vidal de Battini outlines the main thread of all these stories: a bear that kidnaps women and has children with them. The bear-man is indeed the image of a real bear that lives in the Andes but is quite rare in northern Argentina. The stories about Ucumar were known by all those that lived in this area in the 1950s.

The bear that originates this myth according to Vidal de Battini is the spectacled bear (Tremarctos ornatus), the only bear found in South America. A shy jungle beast found from Venezuela to Bolivia on the eastern slopes of the Andes, in the tropical rain forest, and infrequently spotted in Argentina.

It can appear man-like since it, like all bears, can stand up on two feet (see a excellent National Geographic photograph of a standing spectacled bear)

The following image also shows a standing spectacled bear and, a Native American dressed up to resemble it!, more below: [6]

An ukuko - ukuku dancer and a spectacled bear. From [6]

Ukuku "dancers" in Peru

During the Catholic festivity of Corpus Christi, at the Catholic Sanctuary of "Señor de Qoyllorit’i", at Mawayani, in Quispicanchi, close to Cusco, Peru, there are dances and celebrations. One group of "dancers" (they don't actually dance, but accompany the dancers) are men are known as "paulucha", "ukuko" or "ukuku".

They use costumes that make them look bear-like (see photograph above). The dress is called an "unku", which is a kind of long tunic with woollen fringes from which bells and mirriors hang. The man wears a balaclava called "waqollo" that gives his face a bearish look, and carries a whip. He does not dance, actually he follows the dancers and walks around in a clumsy manner. [6]

Their name comes from the native Quechua word for bear, "ukuku". And it originates in an ancient native myth.[6] According the myth, the ancestor of the ukuku was the son of a bear and an Indian woman. He was half man, half animal. He protects humans from the "condemned" that roam around the mountains. These are "living dead", zombies that have been fated to walk the slopes due to the sins that they comitted (especially incest) when they were human. Interestingly the ukuku has a "falsetto" shrill voice, a female voice in a male body.[7] How did our distant relatives the H. erectus vocalize? did they have a squeaky voice?

Bears in the Puna?

The spectacled bear is found in northern Argentina, in Jujuy and Salta, but in the jungles a the foot of the mountains that cordon off the high plateau of the Puna. Its habitat is a jungle known as the "Yungas" ecostystem, with a subtropícal climate. [8]

The Puna (where Mount Macón and Tolar Grande are located, as well as the Escoipe Canyon) is a very arid place, with scarce vegetation and high altitude (averages 4,000 m - 13,100 ft.). No jungle here, only rocks, cliffs, sand flats, boulders, sand, cacti and dry grasses. Rainfall is scarce.

Bear or hominid?

Probly the myth moved from the jungles of the lowlands to the arid high plateau with the natives in Pre Hispanic times. Alternatively the Inca from Peru may have brought their Ukuku myth with them when they conquered the area in the 1450s. Or, the myth may be local and refer to an endemic hominid that lives in the Puna (it could hunt the local camelids: llama, vicuña and guanaco or the taruca deer).

The bear myth seems to have pervaded the Natives of the southern tip of South America, and is found among the Mapuche in Patagonia: see my post on Patagonian bears.

In any case, the myth may or may not refer to a bear. Those who Vidal de Battini interviewed seeme to make it clear that it was bear-like. But they did not say that it Was a bear. Perhaps some grotesque interpretation of a hominid led them to compare it with a bear.

The fact that it can mate with women and men, means that it is a hominid very close to us, modern humans, very likely a H. erectus.

Sources

[1] Edmund Hillary. Epitaph to the elusive abominable snow man. Life Magazine. pp. 72. Jan 13, 1961

[2] George Eberhart, (2002) Mysterious Creatures: A Guide to Cryptozoology. ABC-CLIO, pp. 565

[3] María Constanza Ceruti. (2997). Prospecciones en sitios de alta montaña en el noroeste andino argentino: informe preliminar. 49^th Congreso Internacional Americanista, Quito, Ecuador. July 7-11, 1997.

[4] Ovinsalta.com.ar. Caso Cerro Macon.

[5] Vidal de Battini, Berta Elena, (1960). Cuentos y leyendas populares de la Argentina Vol. 8. Alicante, 2010 pp. 823

[6] Carlos Olivera. (2011). Los ukukos en Qoyllorit’i June 01, 2011

[7] Fernando Martínez Gil, Gerardo Fernández Juárez. La fiesta del Corpus Christi. Univ de Castilla La Mancha. pp 353

[8] Del Moral J. Fernando, Bracho Andrés E. Indicios indirectos de la presencia del oso andino (Tremarctos ornatus Cuvier, 1825) en el noroeste de Argentina . Rev. Mus. Argent. Cienc. Nat. [revista en la Internet]. 2009 Jun [citado 2012 Mayo 12] ; 11(1): 69-76. Disponible en: http://www.scielo.org.ar/scielo.php?script=sci_arttext&pid=S1853-04002009000100008&lng=es.

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2012 by Austin Whittall © 

Caapora - another wild man

This is another entry in my series on “Wild men” in Southern America. Also related to the Curupira, it has a very similar sounding name:

The Paraguayan Caapora. The word comes from the Tupí or Guarani language: and combines two different words: “caa” = jungle and “Porá” = inhabitant. So, the creatures name is quite simple “inhabitant of the jungle”.

This word, in English is pronounced CAH-POH-RA and sounds very similar to COH-ROO-PEE-RAH, the name of the Corupira. But, both names mean different things even though they describe a hominid living in South American jungles. (Perhaps even the same creature, or not –according to Father Joao Daniel).

Description of the “Caapora”

The Paraguayan natives (Guarani people) fear it and describe it as follows:[1]

”a ghost of the forest, with a hairy body, and very strong, that eats people and usually shouts in a very special manner.” [1]

Thoug the word Caapora is Guaraní, there is another native name for it (but the native group is not clearly identified): Kripándufuá [1].

In Southren Brazil, in the state of Paraná, it is depicted as: “a gigantic hairy man, with a large head; that lives in the jungle eating raw, the animals that men hunt and kill, but cannot find “ [1], in other words, he eats the game that wounded gets lost in the jungle.

A goulish feature of Caapora is that he smokes his tobacco in a pipe fashioned from a human skull

It has a horrid voice that sounds like a roaring storm and is very hairy [2]

Another view on the Caapora

We have a description in the Amazon region by a Jesuit missionary, Father Joao Daniel, who worked there among the Indians between 1780 and 1797 and wrote a book about his experiences there (Tesouro descoberto no rio Amazonas). He draws a link between the Caapora and the Curupira. Below he is quoted by Cámara [3]:

”It can be assumed that the Devil, disguised as a human, Coropira, has common communications with our gentle brothers and aldeados [civilized natives living in villages – i.e. aldeias, hence their name aldeados] and even more with the wild ones [uncivilized Indians], who are called Caaporas, inhabitants of the woods”.[3]

So Father Joao’s interpretation is that there are wild “untamed” natives living in the jungles and that they are the Caaopora. And that they and the civilized natives have close ties and communicate with the Coropira devil. They are then, two different creatures!

Sources

[1] Juan Bautista Ambrosetti, (1894). Materiales para el estudio del folklore Misionero. Compañia Sud-Americana de Billetes de Banco, pp 45.

[2] Boletín de historia y antigüedades, (1934). Vol 23, pp 394. Academia Nacional de Historia, Colombia.

[3] Luis da Camara Cascudo, (1972). Dicionário do folclore brasileiro, Volumen 1. pp205.

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2012 by Austin Whittall © 

Ecuadorian Pre-hispanic "horned" beings

 

Pre-Hispanic Ecuadorian native riding a "bull" (?) . From [1]

Being saturday I will keep this post short. Browsing the Internet I came upon the image shown above. Which looks like some kind of "bull rider". The ceramic is on display at the "Museo del Banco Central del Ecuador" according to the source that posts the image, which is said to be Pre-hispanic.

It is a horned (with horns, not antlers) cow-like being. But since bovines were introduced in America by the Spanish conquistadors after 1492, what is this horned being? Furthermore, there is a Pre-hispanic native riding it!

Interesting! I have already posted on Pre-hispanic cattle in Patagonia and other parts of South America. This is just another bit of evidence.

Source

[1] Exploringecuador.com, Museo del Banco Central del Ecuador.

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2012 by Austin Whittall © 

Cieza de Leon and his hairy beings

 

Pedro Cieza de León, (c.1520 - 1554), was a Spanish explorer, born in a well-to-do family who set off at the young age of fifteen on a voyage to the newly discovered continent of America.
He stayed there, taking part in several expeditions in Colombia and Peru. After his return to Spain in 1551, he became a historian and geographer and wrote an account on his adventures (Crónica del Peru), he died shortly after at the age of thirty four.

His "Peruvian Chronicle" (that is the meaning of its title in English) is very interesting and is a good source of information for historians and researchers delving into the first days of the American conquest and the way of life of the American natives.

The Ape-men

I have found some sources that mention Cieza de León's account saying that in it he includes a reference about ape-men that went around in pairs and had a very sharp moan or howl. I decided to check out the "real" and original sources, his Cronicle. Below is the relevant text:

In these mountains and jungles they assert that there are people so wild that they do not have home or clothes and go around like animals, killing birds and animlas with arrows which they eat.
That they do not have lords or captains and that they live in the hollows and boughs of trees in most of which, they also say (though I have not seen them), are female monkeys so large that they move about the trees, and with whom, tempted by the devil, (who always seeks the ways and places for men to commit the worst and gravest sins), these men use them as wives.
And it is said that some give birth th monsters with the heads and limbs like those of men and the hands and feet ape-like. They are, they say, small bodied and with monstrous proportions, and hairy. It seems, alas, they resemble (if it true that they exist) the devil, their father.[1]

He goes on writing that he can not understand why ignorant men “soil themselves” with other beasts, and then mentions that while visitng the region of Charcas in 1549, he spent one night in the tent of a Spanish nobleman who told him the following:

That he had seen with his own eyes, in the mountains, one of these monsters, dead, its shape and sizes as described [above]. And Juan Vargas, a neighbor of La Paz [Bolivia. See map] told him that at Guanuco the Indians told him that they heard the howling of these demons or female monkeys”[1]

Comments

We can clearly see that he is mentioning primitive men (maybe H. Sapiens) native Americans that lived just like they do until this day in the Amazonian jungle, hunting with bows and arrows. These primitive people however lacked huts and lived in the trees.

Furthermore it seems that he is attempting to explain the existence of some odd sightings of dead ape-men reported by the natives to the Spaniards. His explanation: unnatural mating between men and female apes resulting in ape-men offspring. Of course a sixteenth Century Spaniard would blame the devil for these sins.

Finally the howling and moaning part may be true if applied to monkeys: they may well be howler monkeys, which belong to the (genus Alouatta) and comprise fifteen species. They are one of the largest monkeys of South America. They measure up to 90 cm (3 ft.) long and have a prehensile tail. There is no other fit ape in America to play the part of seductress she-monkey.

I guess that the natives had some myth regarding ape-men and that they were the outcome of cross species mating between apes and men. This probably points at some relict homind group of men living in secluded jungle areas of South America during the early days of the Spanish Conquest.


Sources

[1] Pedro de Cieza de León. (1552) Obras completas CSIC, 1984 pp. 120.

The quote above is shown below in Spanish:

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2017 by Austin Whittall © 

Papua New Guinea and Patagonian natives...

 

Papua New Guinea Rock Art. From [1]

 

Patagonian Rock Art. ca. 10,000 BC. Copyright © 2012 by Austin Whittall

I took my vacations during the last two weeks of January 2012, and while I was browsing through books and magazines at an airport bookstore I came across the February 2012 issue of National Geographic Magazine, leafing through it I was startled by the image shown above (top), which very clearly reminded me of some hands painted on a basaltic cliff in Patagonia, the "Cueva de las Manos" (Cave of Hands), which I had visited in 2007; shown in the photograph above (bottom).

More on the "Cueva de las Manos" World Heritage Site of the UNESCO at my website www.TurismoRuta40.com.ar/cuevadelasmanos.html [in Spanish]

The Papuan hands are brighter but bearing in mind that the Patagonian ones date to about 10,000 years BC (12,000 years ago) it is not too surprising.

Austronesians in America

I have already posted (Homo erectus in America - more) about the theory that suggests that native Patagonians differ from the usual "Mongolid" people considered by orthodox science to be the ancestors of all native Americans. This theory says they resemble "Austronesians" in their DNA. (as well as other things; see my previous post on a possible migration route from Australia to Patagonia.

In my book I mention several myths shared by the Australian Aboriginal people and the Tehuelche natives of Southern Patagonia (I exclude the Mapuche natives of Northern Patagonia, who in my opinion are of an Amazonian origin and closely related to the Guaraní people of Paraguay and Brazil).

The striking similarity of the hands painted with the same method (stenciled by blowing paint through a hollow tube) is amazing.

Of course, a hand painted on a wall is a clear human gesture: "this is me", "I am", "I am a person", "I exist", and I am sure that there must be some rock art in European caves with stenciled hands. Yet, it is a very weird coincidence!

I googled "Hands Rock Art Australia" for images and came across the following:

Notice the similarity with Patagonian rock art. All of these are Australian Aboriginal hand paintings. A similar search for "Hands Rock Art Europe" did not return any images of European rock paintings with hands in them.

Furthermore they have a myth (mentioned in the article [1]) which says that the cave, known as Kopao, which has these paintings, was the place that the Meakambut people came from, out of a crack in the rocks made by their god Api.

A similar legend exists among the Tehuelche, where their god brought forth all beings from a cave!

Well, that is all for now. More in my next post.

Photo credits
[1] National Geographic Magazine, Feb. 2012. Last of the Cave People pp 127. Photograph by Amy Toensing.

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia

 Copyright 2009-2012 by Austin Whittall © 

Tachwüll more information

 

The text on Tatchwell.[2]

While conducting some additional research on the Tachwüll (what can I say, I read all I can on Patagonia and sometimes come across interesting information), I came across an article by Mateo Martinic : "Documentos inéditos para la historia de Magallanes 'Memorándum Referido a los Patagones'", published in 2007.[1]
Martinic presents it as an "unpublished" document which was sent to him by Mrs. Jean Cameron, in charge of the Archives at Falkland Islands, which bears the title "Memorandum respecting the Patagonians". The notes did not indicate the author or the year it was written, and Martinic correctly (as we will see below) dates it to around 1840-41.

There are two parts to this story, one regarding the "unpublished" letter, the other about the "Tachwüll". This post will deal with both.

The "unpublished" letter

Martinic was wrong, the letter had been published before, in 1843 by the British Parliament's House of Commons. [2] It was written in 1842 (Martinic was quite close in his estimated time frame):

The above notes were furnished to the Lieut governor by Captain Allen F Gardiner RN who collected them in Patagonia in the early part of the present year 1842. [2]

The text was mentioned again in print in 1964 [3]. So, it was not "unpublished" after all.

The positive thing is that it mentions some people named Tatchwell, and states that they are natives, not dwarves.

Tatchwell or Tachwüll

I will quote Gardiner's text in full (the part that mentions these natives). By the way, Allen Francis Gardiner (1794–1851) was a British Royal Navy officer and missionary and he starved to death in Tierra del Fuego, after an unsucessful attempt to set up a mission among the Yaghans.

First he stated that "There are five tribes of Patagonians [...] and one on the sea coast west of the Cordilleras [...] [these are the] Tatchwell Cho karro west of the Cordilleras 4,000 [population] "[2]

I am at a loss to explain what Cho karro is. But lets go to Gardiners memorandum; he then gives an account that he got from a man, his wife and son, who belonged to the "Tatchwell tribe":
My comments are in brackets:

The district by the Tatchwell is wet and rainy and heavily timbered with trees of great size tents dress and stature is similar to that of the other Patagonian tribes they have canoes but these are only employed for crossing rivers and are merely a light covered with guannco skins.


[Note that they are "the same size" as the other Tehuelche, these Tatchwell are not dwarfs]

They use no paddles but are towed across by their swimming before with a lasso attached to their tails. This country is represented as about north west of Oazy Harbour [Which is located on the Strait of Magellan at 52° 30' S; 70° 31' W ] but in order to reach it is necessary to travel from thence considerably to the northward as the pass through Cordilleras in that part is better suited for horses than one farther south which they do frequent.


[This is correct, there are no passes south of Lake Pueyrredón 47° 16'S. Because of the Southern Continental Ice Field that reaches from the Pacific Ocean coast to the Andean Peaks between lakes San Martín and Mount Payne.]

In the neighbourhood of this pass there is a large lake with an island in it. This of the country and around the lake is inhabited by a tribe called Thit titch whose chief named Tchucato.

[There are several lakes with Islands in them in the area: Lake Belgrano (47°51'S, 72°10'W), San Martín (48°47'S, 72°50'W), Pueyrredón (47°14'S, 72°05'W) and Buenos Aires (46°24'S, 71°45'W. Though Martinic believes that the natives were talking about Lake Nahuel Huapi (41°01S, 71°27'W), which is too far north in my opinion.

I have heard the name Thucato before, but not Thit Titch]

They are more numerous than all the three Choanik [Tehuelche] tribes wear ostrich feathers on heir heads woollen ponchos and a sort of trowsers cultivate ground and have numerous flocks and herds of sheep cattle and horses. Their is different from that of the Choanik they trade occasionally with the Spanish settlements. Through this people they pass on their way across the Cordilleras and direct their course towards the south west [to go to the Strait of Magellan].

[These Thit Titch natives are without doubt, some Mapuche group, because these were Farmers, cattle breeders and weavers. The Tatchwell live to the west of the Andes]

The lake above mentioned they call Chobit it is about seven days on horseback from Oazy Harbour and thence to the Tatchwell on account of the ruggedness of the route and the forests would occupy ten days more. Another tribe called Eaks was also mentioned by the same individual they a district north of the Tatchwell between the Cordilleras and the sea [to the East, the Pacific Ocean as we will see below] but there is intercourse between the two people as their language differs and in one direction a considerable river which they cannot cross in their canoes runs between them.


[Seven days at about 35 km a day (roughly 20 mi.) is 245 km or 150 mi. Then another 10 days or 350 km (217 mi.), the lake's native name is not recorded though, Chobit sounds a lot like Chubut, the name of a Patagonian River and Province.

The distance from Oazy to del Toro Lake by Mount Paine is about 240 km. And this lake has an island in it. An additional 350 km places the territory of the Tatchwell in the area between lakes San Martín, Belgrano and the mouth of Baker River on the South Pacific Ocean.]

The Eaks are a shorter race than the Patagonians and are habited in ponchos. It appears to me probable that the lake called Chobit by these people is the same from Viedmas testimony is marked on the maps Capar [current lake Argentino or perhaps lake Viedma] and the wearing of feathers in the hair and other circumstances related by the Tatchwell man Wao principally the former is I think sufficient to identify the Thet titch with the Pewenches of which nation they are probably a tribe. [2]

Intrigued by this text and the names of different native groups (new to me) I did some further research: [4]



The text above was written in 1851 by the South American Missionary Society (of which Gardiner was its first secretary in 1844). Below is the "text version":

the Tatchwell are found far to the westward near to the eastern slopes of the Cordillera fronting the archipelago of Madre del Dios as nearly as I could ascertain from the account given me by a native of that part of the country whom I met in 1842 during my stay in Coazy [sic] harbour . [4]

Which places these Tatchwell on the Chilean side of the Andes, close to Madre de Dios islands. These are located south of Taitao, and of the Gulf of Penas, (50° 15' 47 S, 75°18' 30 W). This is between del Toro Lake and Baker river's Mouth. To the west of the Continental Ice Sheet. If so, the Tatchwell were living in a dreadful environment, and were very likely Alakaluf canoe people which were not Tehuelche but a differente group, with their own language and culture.

Regarding the Eaks which lived to the north of the Tatchwell, the name does not appear in any book or paper regarding Patagonian natives however, I did find an interesting remark [5] which gives the word used by the Northern Tehuelche (Günnuna Kenna or Gennakenk ), also known as Pampa (or Puelche, the name given to them by the Mapuche): [5]

The Pampa called these groups with the following names: Tehuelche = Ehnakena; Mapuche = Telunakena or Iaskas.

So here we have a word Iaskas (the last "s" is the Spanish plural), whose english pronounciation is easkah, which sounds very similar to Gardiner's Eaks. Furthermore, the fact that they wore woven clothes and had domestic animals and were farmers is a clear indication that they were Chilean Mapuche (the only sedentary natives in Patagonia). However Martinic in his paper [1] says that these may be "Pampas Indians" due to the different language (maybe he is referring to the Mapuche speaking "Puelche" and not the "Tehuelche" speaking Gennakenk which bear the same name.

Summary

There was a native group, of Tehuelche stock living to the west of the Andes somewhere between del Toro Lake and the mouth of Baker River, in Chile. They lived south of the Mapuche (Eaks). Were similar in dress, tents and size to the other Tehuelche of the Patagonia. They used light rafts to cross rivers. They were not dwarves.

The problem is that the only known natives in that area were not Tehuelche but Alakaluf, another totally distinct group, with their own language and clothing and way of life. They did have canoes but did not venture far inland. They did not have horses and did not ride from the Strait of Magellan to the Madre de Dios Islands.

Regadding my dwarf, the Tachwüll, these mysterious natives, the Tatchwell may have recieved their name from the dwarf, as they lived in the same area, in the mountains and forests which the Tehuelche feared and seldom entered.

This deserves some further research and a letter to the journal (Magallania) to rectify Martinic's paper.

New. Nov. 2, 2010 Today I wrote to Magallania, sending them a "comment" about the author and publication in 1843 of this paper as well as some interesting information regarding the "tatchwell". The letter is online, (in Spanish) at the following link:
Comentario sobre un Memorándum inédito referido a los Patagones (Martinic, 2007) by Austin V. Whittall.

Sources.

[1] Mateo Martinic B. DOCUMENTOS INÉDITOS PARA LA HISTORIA DE MAGALLANES "MEMORÁNDUM REFERIDO A LOS PATAGONES". Magallania [online]. 2007, vol.35, n.2 [citado 2010-10-27], pp. 159-164 . Disponible en: . ISSN 0718-2244. doi: 10.4067/S0718-22442007000200013.
[2] Accounts and Papers. COLONIES. Session 2 February 24 August 1843. 33. VOL XXXIII. House of Commons papers, Great Britain. Parliament. House of Commons. HMSO, 1843
[3] Boletín de la Academia Nacional de la Historia, (1964), Academia Nacional de la Historia (Argentina). vol. 35, pp. 280.
[4] South American missionary society, (1851). Remarks on the Aborigines of South America from Personal Observation THE PATAGONIANS. In The Voice of pity for South America . London, J. Nisbet & Co. pp 92+
[5] Bórmida, Marcelo, and Casamiquela, Rodolfo (1958). Etnografía gününa-kena. Testimonio del último de los tehuelches septentrionales. Runa, Buenos Aires, vol. 9, nºs 1-2, pp. 153-193

---

Lea este post en español

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia

2010 International Year of Biodiversity Copyright 2009-2010 by Austin Whittall ©