An intro to Y chromosome haplogroups

My last post mentioned the possibility of Denisovans being linked to Haplogroup P of the Y chromosome, and the possible presence of haplogroup P in America. I thought that it would be straightforward to associate Denisovans with haplogroup P. But after giving it some thought, it isn't. So I decided to recap and go back to the basics and try to find out if it is feasible to associate Denisovans with any human Y chromosome haplogroup.

Transmission and Mutations of Chromosome Y

Chromosome Y is inherited in a patrilineal manner. All men carry one chromosome X and one chromosome Y, they inherit the X from their mothers and the Y from their fathers. In human beings, carrying a pair of X and Y means you are a man. If you inherit the X from both parents, you are a woman.

Base Pairs

Like all chromosomes, Y is made up of DNA (Deoxyribonucleic acid) a molecule that is made up of two counter-spiraling helicoids (like a winding circular stairway), both strands are made up of sugar-phosphate and are the backbone onto which four different compounds (bases) attach. These are Adenine (A), Cytosine (C), Guanine (G), and Thymine (T); these are the steps of the stairway. The bases bind in a particular way, A with T and G with C.

DNA carries the instructions that the cells can read and use it as a template to build proteins.

The bases are laid down in a certain sequence along the spirals, for instance one strand could have: A T G C C T A G T... and the opposing one would have the complementary bases (a T for every A, a C for each G, and viceversa): T A C G G A T C A...

Each pair of linked bases (the rungs of the stairway) is a base pair, for instance A—T. There are 60 to 300 million base pairs in each of our 46 chromosomes, a total of around 3 billion of them in our genome.

Chromosome Y is the smallest in terms of base pairs: roughly 60 million on average.

Genes

Genes are a specific sequence of aligned base pairs in one chromosome. They are the basic unit of heredity. A gene has the codes required to produce special molecules known as RNA or specific proteins.

When cells replicate, or in the case of our sexual gametes (ovarian eggs and sperm), the chromosomes undergo a process of splitting and the DNA strands unwind and replicate. With 3 billion base pairs, copying the new strands can lead to alterations in the base pairs: mutations.

Some base pairs are lost (deletions) others are copied twice (duplications). This alters the blueprint and may have an impact on how the gene that contains these mutations functions. Mutations can be negative (deleterious), neutral, or even positive. As we will see below, mutations in chromosome Y are problematic, as they accumulate.

Hominin Evolution

Our closest primate relative is the common ancestor that we share with chimpanzees, who lived between 6 and 8 million years ago.

This distant ancestor evolved, through a series of mutations into our homo ancestors: Homo habilis and Homo erectus, and others, reaching the common ancestor of Neanderthals, Denisovans, and Homo sapiens.

The original male hominins living 3 or 4 million years ago, carried certain base pair sequences in their Y chromosomes. We can imagine a small population with a few hundred males sharing identical base pairs (this is of course an over simpification, they differed). These "men" then passed their Y chromosomes with these same sequences to their sons. Some of them probably died in their childhood and did not mate, others only had daughters, so their Y chromosomes were lost, only those who had sons passed them on to the next generation.

Mutations

Each generation went through the same process, but the sequences that were passed on, changed over time as chance and external factoes introduced random mutations in the base pairs of the DNA strands of the Y chromosome.

Below are some of the factors that cause mutations:

• Chance, random mutations.
• Age of conception, those men who reproduce later will have more male germ-cell divisions, and each division entails the risk of a failed copy in the sequence. Formation of sperm (or spermatogenesis) implies constant cellular division over a man's lifespan. Female oocytes that result in eggs are all produced at birth, in one go.
• Methylation, the addition of a methyl group (—CH₃) to the DNA strand due to epigenetic (lifestyle or external) factors such as stress, famine, or toxins (alcohol, chemicals, smoking).
• Oxidative stress. Sperm are also modified by inflammation, heat, radiation (cosmic rays) which can produce free radicals which are oxidants and degrade the DNA.
• Inadequate repair systems, although the Y chromosome has limited repair mechanisms as it is mostly non-recombining (it has no partner like the other non-sexual chromosomes and does not recombine with the X chromosome). It has limited ability to fix glitches due to its high content of repeat sequences called palindromes.

Unlike other chromosomes, mutations can't be purged in Y chromosomes, so if they are harmful, they will accumulate and lead to genetic malfunction (sterility, illness, death, stillborn boys, and miscarriages). The chromosome will not work as expected. Mutations can reverse, undoing the original variation, but it is an unusual event.

The hominins evolved, but the basic structure of their Y chromosomes was similar, only the accumulated mutations, those that had allowed viable offspring survived, the others vanished as those who carried them died.

The whole genome is subjected to mutations, the X chromosome, and the other chromosomes, and natural selection acts, promoting the survival of the mutations that provide an advantage to those carrying them. It is possible that certain Y chromosomes, even though they were fit and possibly provided survival benefits, were eclipsed by deleterious mutations in other chromosomes. This led to the loss of many Y chromosome variants that had evolved over millennia.

The image Below shows an extremely oversimplified version of a Y chromosome. The original, ancestral version is (1) it has 50 million base pairs (not shown), but one mutated, say an A for a T (shown with the red band). It survives in the following generation and after many generations during which othe over the years, and today, when we look at the global population and sample the men, we find the variants marked (2) to (8), each one carries the original "red" mutation but have added others, each identified with a different color (blue, black, orange, green, violet, and gray).

Y Chromosome markers explained. Austin Whittall ©2026

Haplogroups

Here is where modern geneticists and anthropologists use their computer software tools, algorithms, and theory to build phylogenetic trees. They choose certain base pair mutations known as SNPs as "markers" that define "haplogroups" that split populations into branches from a main trunk (the basal one). Assuming that there are no back-mutations, and that repeat mutations are extremely uncommon, they propose that each marker (a mutation at a given base pair) that is fixed in a given population arose in a sequential manner.

In the example shown above, the phylogenetic tree would be the one shown below, assuming that mutations accumulate and don't reverse:

Caveats

We could argue that (8) resulted from (4) that lost its "blue" mutation, but as mentioned further up, orthodoxy considers that back mutations are rare so they ignore them. Problems also arise when we ask which mutation came first, (2), (7), or (8) they are all just one mutation away from the ancestral root.

In the real world, this is far more complicated, especially when we sequence the Y-chromosome of Neanderthals and Denisovans, which have degraded, decayed, and are incomplete. The strands of DNA of ancient remains are full of voids, and bases that have switched, or flipped. Comparing them with modern strands is done with software that "matches" them and points out the differences.

Toomas Kivisild (2017) highlights the complexity of analyzing haplogroups in ancient Y-chromosome samples: "it can be challenging to distinguish true mutations from those induced by damage, particularly in case of C to T and G to A substitutions", contamination is another factor, and the errors caused by low quality readings caused by "coverage" (how many sites were measured in a sample for comparison with a reference genome) and "sequencing depth" (how many reads covered the sample). All of them can lead to incorrect branch lengths, tree inferences, and dating.

SNPs

And mutations can appear in markers leading to mistaken identifications, like the ones reported by A.T. Fernandes, R. Goncalves, and A. Brehm (2004), in the Azores, where "It was found that some individuals share the same haplotype but belong to different Y-chromosome haplogroup suggesting that SNP mutations may occur frequently." SNPs are Single Nucleotide Polymorphisms (a switch in one base, like an A for a T). This paper notes that "The human Y-chromosome haplogroups are characterized by several mutations according to the phylogeny and nomenclature proposed by the Y-chromosome Consortium. Haplogroups are considered to be stable due to the very low mutation rate of most binary markers (SNPs), around 10⁻⁹ per base per generation, showing evidence of recurrent mutation at only 6 of 240 SNPs." This study involved 240 unrelated men and found "three individuals that share an haplotype with a double duplication suggest[ing] that a recurrent mutation occurred in SNP M78 because the duplication event is rare and it is unlikely to occur twice. For the individuals sharing the same haplotype but belonging to different haplogroups two explanations can be possible: recurrent mutations in several SNP namely in M78 and M81 (E3b1/E3b2) and M172 (J/J*) or several STR mutations may have occurred." So much for haplogroups and the assumptions that they are based on! 6 in 240 may seem a low frequency but it is high, 2.5%.

STR, mentioned above is a Short Tandem Repea, a snip of 2 to 6 base pairs long that is repeated two or more times in a location along the DNA strand.

The Branches of the Haplogroup tree

Another factor to consider when looking at ancient and modern DNA is that a man who died 50,000 years ago shows us a picture of a lineage that stopped accumulating mutations then. During the following 50,000 years all other lineages continued adding mutations to their DNA strands at a rate of 10^-9 per base per generation (I am using the SNP haplogroup marker value given above). So assuming generations of 25 years, in 50 ky, there are 2000 generatons, and with 50 million base pairs in a Y chromosome, we can calculate 50 x 10⁶ x 2 x 10³ x 10^-9 = 100 mutations.

When we look at our last shared common ancestor with the Denisovan group who lived ~550,000 years ago, if we assume no mixing with these people since then. After 500 ky, when we met them again in Asia during the Out of Africa migration, each branch, ours, and theirs would have accumulated an average of 1000 mutations (1000 in 50 million base pairs is a very low proportion: 0.002%). With Neanderthals from who we split later, around 350 kya, and met during our first Out of Africa 150 kya, only 400 mutations would have accumulated during the 200 ky we remained apart.

Intra Homo sapiens comparisons like the ones that compare a modern Chinese or a Native American from the Amazon, with an African San, are comparing lineages that have accumulated mutations since they split, probably 60 ky (Chinese and Amerindian) ago from the African line, accumulating mutations separately since then ~120 mutations in each line. And Native Americans with a 30 ky split from Chinese would have added 60 mutations.

Branch Shortening

Finally, and this will be the subject of my next post, mutations do not accumulate at the same rate. Africans have "shorter branches" on the phylogenetic trees. A paper by Petr et al, (2020) using data from an ancient man found in Siberia, Ust’-Ishim, 45,000 years old and modern humans noticed that the number of mutations from the root of each "branche" that leads to Africans and Non-Africans differed, implying different mutation rates (or, in my opinion, incorrect dating of the root, or fork): "Importantly, we discovered that the branch-lengths in Africans are as much as 13% shorter compared to non-Africans, which is consistent with significant branch length variability discovered in previous studies and suggested to be a result of various demographic and selection processes. Notice how they attempt to explain the issue away with "various" processes.

Further reading. Though old and dated, it is short, clear, and comprehenisive. Mark A. Jobling and Chris Tyler-Smith, (2003). The human Y Chromosome an evolutionary marker comes of age, Nat Rev Genet. 2003 Aug;4(8):598-612. doi: 10.1038/nrg1124.

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2026 by Austin Whittall © 

Alcohol, genes and human migrations... Part 1

I am Always on the look out for interesting papers that identify crucial differences between Native Americans and Asians: since Asia is the alleged homeland of Amerindians we would expect Asians and Americans to be similar, not different, so discrepancies between them are interesting (because they must be explained to justify the theory of a Beringian migration of Asians into America).

So, the other day, when I came across a map which depicted the global distribution of the ADH1B*47His allele (more on it later), I was delighted. The map, shown below, depicts a contrast between America is shaded in white and East Asia shaded dark.

Furthermore, America is similar to Subequatorial Africa, Western and Northern Europe and the Arctic region of Central Siberia, and very different from Asia, PNG and Australia. [1]

Global contour plot of ADH1B*47His Allele. From Fig. 2 in [1]

So as clear as Black and White, America (white) is different to Asia (Black). Something is going on. Apparently America, Europe and Africa share a common trait not found in the rest of Eurasia and Oceania. This is indeed another case of an Amerindian gene not shared by their alleged Siberian or Asian "relatives".

I decided to take a deep look into the matter. And first of all, find out what was this ADH1B*47His Allele is all about... and the story is quite interesting.

On food, alcohol and genes

Fruit is a primary source of energy for many insects and animals, including our primate ancestors. Overripe fruits, in a warm and humid tropical environment can ferment and attain a considerable level of alcohol (even as high as 8.1% - about half way between wine and beer), this is quite intoxicating and has evolutionary implications.

Monkeys eating this kind of fruit would get drunk and unless they developed some mechanism to get rid of the alcohol, would face serious problems in the wilderness: a tottering and drunk or even a hung-over ape would be an easy prey for a sober lion or leopard.

Since our hominid ancestors also ate a considerable quantity of fruit, they too would have had to deal with alcohol in their systems. Somehow they would have to cope with optimizing the fruit as a food resource, with the alcoholic consequences of its ingestion: Alcohol metabolization is something that over the course of thousands of years would selected for, or against, by the forces natural selection.

It appears that the common ancestor of both humans and chimpanzees developed the ability to metabolize alcohol about 10 mya [2]. We still carry this adaptation in our genes. But not all humans have the same set, there are differences, and their effects are noticeable.

About metabolizing alcohol

The alcohol we ingest is absorbed into our blood stream and besides giving us an "alcoholic high", it goes through our liver which breaks it down into other compounds.

There are two kinds of enzymes that metabolize alcohol: ADH, or Alcohol Dehydrogenase and ALDH or Aldehyde Dehydrogenase. They work in tandem to rid us of alcohol:

ADH tuns ethanol (ethyl alcohol) into acetaldehyde, a nasty toxic substance which which provokes nausea, hedaches, hangover and flushing. The aldehyde in turn is metabolized by ALDH into acetic acid (actually, acetate, the ion) which is finally eliminated as waste.

The reactions are the following:

H₃C - CH₂-OH (ethanol) -- ( ADH ) --> H₃C - CH=O (acetaldehyde)

H₃C - CH=O (acetaldehyde) -- ( ALDH ) --> H₃C - COOH (acetic acid)

The interesting part of this is that there are different alleles of the genes that code for these enzymes, and that these are found at different frequencies among human populations around the world (like shown in the maps above and below).

ALDH alleles and aldehyde

It appears that people who carry a mutated allele of ALDH2*2 gene, the ALDH2*487Lys, are less likely to become alcoholics (Huai-Rong, Luo et al, 2009) [3], and the reason is very straightforward: the mutation reduces the enzyme's ability to convert acetaldehyde into acetic acid, therefore acetaldehyde accumulates in the body, dilates capillaries provoking a flush, and other negative hang-over consequences such as headaches and nausea. Since drinking becomes unpleasant, the carriers of this mutation tend to avoid drinking and remain sober.

Other people, lacking this mutation, turn aldehyde into acetic acid more efficiently, so drinking, for them, is pleasant, which increases the risk of alcoholism.

It appears too, that the "deficiency allele is of interest because natural selection in the form of conferring resistance to parasite infection may have preserved this allele in Asia" [4], so besides keeping its carriers sober, it kept them healthy too. This would also be something that natural selection processes could act upon, reinforcing the presence of this allele.

This ALDH2*2 mutation is predominant among people of East Asian descent. (between 26 and 46% of Chinese, Japanese and Koreans carry it), it falls to 13-6% in the surrounding areas and to less than 3% in India, Europe and Papua New Guinea; it is absent among Native Americans. So we can guess that the latter populations will tend to be more alcoholic than the former.

Map showing the global distribution of ALDH2* alleles. The red segments indicate the "Asian" mutation. Adapted from [3]

The paper (Huai-Rong, Luo et al, 2009) [3], contends that the "limited distribution of atypical allele ALDH2*487Lys indicated a recent expansion event."; and they believe that it originated recently in the Pai-Yuei tribe in Southern China 2 to 3 kya., maybe because they cultivated rice. Which may be the case. They do not present any proof regarding their dating, so I will take it as an educated guess.

The interesting part is the following:

The weight of the "other" alleles in America also differ from those in Asia:

There is no GCCTA or "Asian allele" (shaded red in the map) in America (or elsewhere). This is exclusively Southern and Eastern Asian.

The ATCTG type (shaded pale violet in the map) is predominant in Central and Southern America (45 - 90%) whose average is the same as that of Europe (66.8%). It drops off in the rest of the world: South West Asia (47.3%) and PNG (45%), and is lowest in Africa (3%) [5].

It is also found in low frequencies in North America (avg. 33%), and Northern Asia (less than 25%, in Siberia: 13%). It is even lower in East Asia (4.9%). [5] The fact that it has a global distribution points at an ancient origin, and being present in Africa at such low frequencies, indicates, in my opinion, that it probably back-migrated into Africa after originating out of Africa somewhere from where it dispersed globally (the Middle East?).

However (Oota et al., 2004)[5] despite being the most common global haplotype, it is recent. They give two reasons:

1. "The HaeIIIc site [which defines this allele ATCTG] is not polymorphic in five sub-Saharan Africans [...] The results indicate the HaeIIIc site [is] relatively young polymorphism.". This is so, despite the fact that " the ages of the other polymorphic sites we examined are as old as modern humans’ expansion" [5]
2. The inferred evolution of this allele (ancestral --> ACCTG --> ATCTG) or sequential pattern of mutations also indicates that the HaeIIIc polymorphism is relatively young". Oota et al., argue that it is two mutations away from the ancestral form and therefore young. But, so is the GCTCG allele (pale blue on map) yet they belive that it is as old as modern human expansion.

There is also the ancestral lineage, which in Asia and Africa accounts for 33 - 55% of alleles but is virtually absent in Europe and Southwest Asia (1.4% and 7.2%, respectively) yet it is present in America at frequencies of 5 - 33% (lower in South America, higher in North America). It is, in general quite common (10.0%– 53.9%) elsewhere. [3][5].

The GCTCG (pale blue in the map) haplotype is "ubiquitously distributed, it would appear to have arisen in Africa and drifted to an appreciable frequency prior to the expansion of modern humans out of Africa" [5]. This too is two mutations away from the ancestral version and there are two possible variants, involving two rare alleles:
ancestral --> GCTTG (found among the Han Chinese) --> GCTCG
ancestral --> GCCCG(found among the Ugyurs) --> GCTCG

Despite being two mutations away from the ancestral line, it is deemd as ancient! While the "Asian" allele, (red in map) GCCTA supposedly only one mutation away from the ancestral allele is deemed to be recent!.

STRP D12S1344 and some genetic theory

Oota et al., 2004) [5] dug deeper in the geographic variation of these alleles. They included the short tandem repeat polymorphism (STRP) STRP D12S1344 and graphed the distribution of the 5-SNP haplotypes (the ones mentioned above: GCCTG, CGTCG, ACCTG, ATCTG, GCCTA) according to the STRP's alleles.

Let me explain this first (It took me some time to understand what they did and its implications), below is some theory.

STRP stands for Short Tandem Repeat Polymorphism.

The DNA sequence of different people varies in some parts of our chromosomes. These variations are known as "Polymorphisms". There are some special kinds of polymorphisms known as "Short Tandem Repeats", which are interesting for the study of genetics, so the study of these STRPs is important.

Four nucleotides: guanine (G), adenine (A), thymine (T), and cytosine (C) make up the nucleic acid of DNA.

STRPs are relatively short sequences of DNA (hence the "Short" part of the name"), comprising between 2 and 5 base pairs that are repeated (hence the "Repeat" part of the name) one after the other in "Tandem". The result is a sequence of the repeated unit. In the case of STRP D12S1344, the repeat is a two base pair (therefore, a dinucleotide), "CA" (cytosine and adenine) which is repeated n times. For instance: "CACACACACA" is a 10 bp sequence of a 5 tandem repeat of the dinucleotide "CA".

Since different individuals carry different repeat numbers, these are "polymorphisms" that differentiate one person from the next: for instance: One individual may have 5 repeats, the other 6, and yet another 8. These repeats arose from mutations in their ancestors.

STRs are usually considered “junk DNA” because they are introns and do not code for protein, changes in them do not affect the people carrying them. They are neutral to the forces of natural selection.

In the case of our STRP D12S1344, it was chosen because it is downstream of the ALDH2 gene locus. This STRP was "typed" (that is, it was sequenced) and its repeats were found to vary between 11 and 25 among all humans. These represent different polymorphisms. And each different repeat value indicates a different allele. These were given names: for repeats n=11 the allele was named "allele 222", n=12 was named "allele 224" and so on, until n=25 which was named "allele 250". [7]

By "repeat" we mean exactly that; so in allele 222, the "CA" dinucleotide is repeated eleven times. Below we see the eleven repeats flanked by the remaining sequence common to all humans:

... TCGTTTTCTGGGATACACACACACACACACACACACA TTCTGTCCTTCTTTT...

What causes the appearance of different polymorphisms in a given population? (Why does Joe have n=14, Jane have n=22 and Wang have n=15?).

They arise due to chance mutations that happen at a very low rates: between 1:100 and 1:1,000,000 per generation. [6]

They are mostly formed due to "replication slippage", whereby the DNA strands are mismatched during DNA replication and a repeat is added (or removed) from the resulting duplicate.

Since slippage is a symmetrical process, repeats are added and also removed. The outcome is that new alleles with a higher number of repeats are added and others are lost by removal.

Nevertheless, they are, in general, conserved over long evolutionary time spans and it seems that long repeats tend to shorten while short ones lengthen [6] even though insertions might tend to be self-accelerating and grow as the probability of a future mispairing increases.

Since natural selection operates on other parts of our DNA (those that code proteins), but not on the "junk DNA " of STRPs, the origin and evolution of different frequencies of repeats is due to chances (which adds or removes repeats), also to selection operating on the coding part of DNA and finally from the admixture with other populations having a different repeat mix in their genes.

We can imagine a group of people sharing a certain coding DNA due to their common ancestry and also the same repeat in an STRP. Should selection select against or for the trait coded by that DNA, then the STRP would be favored or disadvantaged because it shares the fate of the evolutionary pressures on the DNA it is piggy-backing on.

So there are three factors that interplay in the repeat alleles: chance, selection and admixture.

STRP D12S1344 continued

When comparing the STRP among different human groups, Oota et al., (2004) [5] found the following distribution of alleles (remember, the x axis indicates the number of repeats 222 is n=11 and 250 is n=25). The color depicts the relative frequencies of the 5-SNP haplotypes (the ones mentioned above: GCCTG, CGTCG, ACCTG, ATCTG, GCCTA) for each repeat allele. The number beside each region is the amount of populations sampled (yes, South America is always under-sampled, only three populations were considered: Karitiana, Surui and Ticuna [7]):

ALDH-2 5-SNP haplotypes of each repeat Allele at STRP D12S1344. Adapted from Fig. 4 Oota et al., [5]

So, what does it mean?

Let's take a look at it with a regional perspective:

• Africa, as expected, has a predominance of the Ancestral alleles (in black). The frequency histogram has a bimodal distribution with two clusters, one between 226 and 230, the other from 234 to 250. With the highest values at 238 and 240. In total, 12 alleles.
  There is a touch of GCTCG (pale blue) and similar amount of ACCTG (green), both widely spread.
  No "Asian" GCCTA (red), a clear indication of its East Asian origin.
  Very little ATCTG, (violet), at allele 236.
• Following the imagined tracks of an Out of Africa migration, we can see the shared traits of both South Western Asia (it has 11 alleles) and Europe (ten alleles), which are the closest to Africa.
  We see, with surpirse how the ancestral (black) lineage is virtually gone.
  The prevalence of ATCTG (violet), in contrast with Africa, and a similar content of GCTCG or (Blue). ACCTG (green) is also similar to Africa.
  The prevalence of repeat 240 has decreased and repeat 236 has grown to a similar frequency as 240. While the second "peak" at 226-230 is still there.
• East Asia, with is peculiar mutation, maintains a very high proportion of the ancestral lineage, though it has lost some longer repeats (246 to 250). It kept the second the peak at 226-230.
  It also mantains a predominance of the 240 and 238 repeat like Africa, and it is there that the GCCTA, Asian mutation (in red) appears.
  Repeat 240 reached a +50% frequency, fifty percent higher than the 30% frequency of this repeat found in other regions. Nine alleles are found in this region.
• Siberia. Not graphed by Oota. The Siberian Yakut, [7] are quite unlike the North and South American natives: they have a maximum of 42.2% at repeat 226. The highest in the World for this allele. Are these the ancestors of the Amerindians? It seems unlikely
• North America. The histogram shifts to the right: 242 and 244 repeats grow considerably:15% frequency at 244. The second "peak" at 226-230 still appears.
  The ATCTG, (violet) allele is found in much higer frequencies than in East Asia or Africa, but lowe than S.W. Asia and Europe. And the ancestral allele is also found at high frequencies, higher than S.W. Asia and Europe, but lower than East Asia or Africa. There are 9 alleles in this region.
• South America. The "second peak" has disappeared (226-230 repeats). And also, there is an increase of higer repeat frequencies, even more than those found in North America: there is a peak at repeat 244 of 25%, highest globally (mostly ATCTG - violet), and also at 238 with 20%, also a global high.
  The ancestral (black) allele is lower than N. America, East Asia and Africa. Only 7 alleles are present in this region.
  South America has the "two pronged" high frequencies on the right side of the histogram, just like Europe and S.W. Asia. All other regions have only one maximum on the right side.

Neanderthal admixture?

Since non-Africans admixed with Neanderthals, you might expect that the characteristic alleles of Neanderthals would appear in humans. I have not found any paper regarding this to be able to quantify it.

Nevertheless, the signal should be there. The sharp difference between European and S.W. Asian alleles on one side and the Asian, African and North American on the other is noticeable. The former have a one prong maximum at 240 while the latter have a two prong maximum in that area.

To me this spells "Admixture": mixing of two populations makes certain frequencies grow: those in which both populations overlap will grow, where no overlap exists, the frequency will decline. The exact amounts depend on the histograms of each population and the admixture ratio. I will do some simple simulations in part 2 of this post.

The double prong maxima is basically made up of ATCTG, the violet color mallele. Could this be a Neanderthal allele?

The Native Americans in South America have lost part of their alleles (the second peak centered on 226): perhaps due to a bottleneck in the population as it moved into South America, or maybe even later, 500 years BP, during the conquest, when millions of natives died due to disease brought by the European conquerors.

The alleles that did survive were those shared with Europeans (ATCTG, violet) -which may even be of Neanderthal origin- perhaps because they were related to coding areas common to Europeans and therefore granting protection against disease brought by them to America.

At repeat 240, compared to North America, the ancestral allele decreased at the expense of a growth in the ATCTG - violet one.

ACCTG (green) also survived, in lower frequencies than in North America and, again, at those frequencies common to Europeans: 236 to 242.

I wonder what would the DNA sequences of prehispanic natives show? Was the repeat diversity richer? Did they (and in this I include North American Natives), have a wider dispersion? Other haplotypes now extinct?

Continued in Part 2...

Sources

[1] Hui Li, et al., (2007). Geographically Separate Increases in the Frequency of the Derived ADH1B*47His Allele in Eastern and Western Asia. Am. J. Hum. Genet. 2007;81:842–846. DOI: 10.1086/521201
[2] Carrigan, M. A., et al., (2012). The Natural History of Class I Primate Alcohol Dehydrogenases Includes Gene Duplication, Gene Loss, and Gene Conversion. 7, s.l. : PLoS ONE, 2012, Vol. 7.
[3] Huai-Rong Luo, (2009). Origin and dispersal of atypical aldehyde dehydrogenase ALDH2*487Lys. Gene 435 (2009) 96–103
[4] Raymond J. Peterson, David Goldman and Jeffrey C. Long, (1999). Effects of Worldwide Population Subdivision on ALDH2 Linkage Disequilibrium. doi:10.1101/gr.9.9.844 Genome Res. 1999. 9: 844-852
[5] Oota,H., Pakstis, A.J., Bonne-Tamir, B.,Goldman,D., Grigorenko, E., Kajuna, S.L., Karoma,N.J., Kungulilo, S., Lu, R.B.,Odunsi, K.,Okonofua, F., Zhukova,O.V., Kidd, J.R., Kidd, K.K., (2004). The evolution and population genetics of the ALDH2 locus: random genetic drift, selection, and low levels of recombination. Ann. Hum. Genet. 68, 93–109. doi: 10.1046/j.1529-8817.2003.00060.x
[6] Christian Schlötterer, (2000). Evolutionary dynamics of microsatellite DNA. Chromosoma, September 2000, Volume 109, Issue 6, pp 365-371
[7] The allele frequency database ALFRED

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall ©