Alcohol, genes and human migrations... Part 1

I am Always on the look out for interesting papers that identify crucial differences between Native Americans and Asians: since Asia is the alleged homeland of Amerindians we would expect Asians and Americans to be similar, not different, so discrepancies between them are interesting (because they must be explained to justify the theory of a Beringian migration of Asians into America).

So, the other day, when I came across a map which depicted the global distribution of the ADH1B*47His allele (more on it later), I was delighted. The map, shown below, depicts a contrast between America is shaded in white and East Asia shaded dark.

Furthermore, America is similar to Subequatorial Africa, Western and Northern Europe and the Arctic region of Central Siberia, and very different from Asia, PNG and Australia. [1]

Global contour plot of ADH1B*47His Allele. From Fig. 2 in [1]

So as clear as Black and White, America (white) is different to Asia (Black). Something is going on. Apparently America, Europe and Africa share a common trait not found in the rest of Eurasia and Oceania. This is indeed another case of an Amerindian gene not shared by their alleged Siberian or Asian "relatives".

I decided to take a deep look into the matter. And first of all, find out what was this ADH1B*47His Allele is all about... and the story is quite interesting.

On food, alcohol and genes

Fruit is a primary source of energy for many insects and animals, including our primate ancestors. Overripe fruits, in a warm and humid tropical environment can ferment and attain a considerable level of alcohol (even as high as 8.1% - about half way between wine and beer), this is quite intoxicating and has evolutionary implications.

Monkeys eating this kind of fruit would get drunk and unless they developed some mechanism to get rid of the alcohol, would face serious problems in the wilderness: a tottering and drunk or even a hung-over ape would be an easy prey for a sober lion or leopard.

Since our hominid ancestors also ate a considerable quantity of fruit, they too would have had to deal with alcohol in their systems. Somehow they would have to cope with optimizing the fruit as a food resource, with the alcoholic consequences of its ingestion: Alcohol metabolization is something that over the course of thousands of years would selected for, or against, by the forces natural selection.

It appears that the common ancestor of both humans and chimpanzees developed the ability to metabolize alcohol about 10 mya [2]. We still carry this adaptation in our genes. But not all humans have the same set, there are differences, and their effects are noticeable.

About metabolizing alcohol

The alcohol we ingest is absorbed into our blood stream and besides giving us an "alcoholic high", it goes through our liver which breaks it down into other compounds.

There are two kinds of enzymes that metabolize alcohol: ADH, or Alcohol Dehydrogenase and ALDH or Aldehyde Dehydrogenase. They work in tandem to rid us of alcohol:

ADH tuns ethanol (ethyl alcohol) into acetaldehyde, a nasty toxic substance which which provokes nausea, hedaches, hangover and flushing. The aldehyde in turn is metabolized by ALDH into acetic acid (actually, acetate, the ion) which is finally eliminated as waste.

The reactions are the following:

H₃C - CH₂-OH (ethanol) -- ( ADH ) --> H₃C - CH=O (acetaldehyde)

H₃C - CH=O (acetaldehyde) -- ( ALDH ) --> H₃C - COOH (acetic acid)

The interesting part of this is that there are different alleles of the genes that code for these enzymes, and that these are found at different frequencies among human populations around the world (like shown in the maps above and below).

ALDH alleles and aldehyde

It appears that people who carry a mutated allele of ALDH2*2 gene, the ALDH2*487Lys, are less likely to become alcoholics (Huai-Rong, Luo et al, 2009) [3], and the reason is very straightforward: the mutation reduces the enzyme's ability to convert acetaldehyde into acetic acid, therefore acetaldehyde accumulates in the body, dilates capillaries provoking a flush, and other negative hang-over consequences such as headaches and nausea. Since drinking becomes unpleasant, the carriers of this mutation tend to avoid drinking and remain sober.

Other people, lacking this mutation, turn aldehyde into acetic acid more efficiently, so drinking, for them, is pleasant, which increases the risk of alcoholism.

It appears too, that the "deficiency allele is of interest because natural selection in the form of conferring resistance to parasite infection may have preserved this allele in Asia" [4], so besides keeping its carriers sober, it kept them healthy too. This would also be something that natural selection processes could act upon, reinforcing the presence of this allele.

This ALDH2*2 mutation is predominant among people of East Asian descent. (between 26 and 46% of Chinese, Japanese and Koreans carry it), it falls to 13-6% in the surrounding areas and to less than 3% in India, Europe and Papua New Guinea; it is absent among Native Americans. So we can guess that the latter populations will tend to be more alcoholic than the former.

Map showing the global distribution of ALDH2* alleles. The red segments indicate the "Asian" mutation. Adapted from [3]

The paper (Huai-Rong, Luo et al, 2009) [3], contends that the "limited distribution of atypical allele ALDH2*487Lys indicated a recent expansion event."; and they believe that it originated recently in the Pai-Yuei tribe in Southern China 2 to 3 kya., maybe because they cultivated rice. Which may be the case. They do not present any proof regarding their dating, so I will take it as an educated guess.

The interesting part is the following:

The weight of the "other" alleles in America also differ from those in Asia:

There is no GCCTA or "Asian allele" (shaded red in the map) in America (or elsewhere). This is exclusively Southern and Eastern Asian.

The ATCTG type (shaded pale violet in the map) is predominant in Central and Southern America (45 - 90%) whose average is the same as that of Europe (66.8%). It drops off in the rest of the world: South West Asia (47.3%) and PNG (45%), and is lowest in Africa (3%) [5].

It is also found in low frequencies in North America (avg. 33%), and Northern Asia (less than 25%, in Siberia: 13%). It is even lower in East Asia (4.9%). [5] The fact that it has a global distribution points at an ancient origin, and being present in Africa at such low frequencies, indicates, in my opinion, that it probably back-migrated into Africa after originating out of Africa somewhere from where it dispersed globally (the Middle East?).

However (Oota et al., 2004)[5] despite being the most common global haplotype, it is recent. They give two reasons:

1. "The HaeIIIc site [which defines this allele ATCTG] is not polymorphic in five sub-Saharan Africans [...] The results indicate the HaeIIIc site [is] relatively young polymorphism.". This is so, despite the fact that " the ages of the other polymorphic sites we examined are as old as modern humans’ expansion" [5]
2. The inferred evolution of this allele (ancestral --> ACCTG --> ATCTG) or sequential pattern of mutations also indicates that the HaeIIIc polymorphism is relatively young". Oota et al., argue that it is two mutations away from the ancestral form and therefore young. But, so is the GCTCG allele (pale blue on map) yet they belive that it is as old as modern human expansion.

There is also the ancestral lineage, which in Asia and Africa accounts for 33 - 55% of alleles but is virtually absent in Europe and Southwest Asia (1.4% and 7.2%, respectively) yet it is present in America at frequencies of 5 - 33% (lower in South America, higher in North America). It is, in general quite common (10.0%– 53.9%) elsewhere. [3][5].

The GCTCG (pale blue in the map) haplotype is "ubiquitously distributed, it would appear to have arisen in Africa and drifted to an appreciable frequency prior to the expansion of modern humans out of Africa" [5]. This too is two mutations away from the ancestral version and there are two possible variants, involving two rare alleles:
ancestral --> GCTTG (found among the Han Chinese) --> GCTCG
ancestral --> GCCCG(found among the Ugyurs) --> GCTCG

Despite being two mutations away from the ancestral line, it is deemd as ancient! While the "Asian" allele, (red in map) GCCTA supposedly only one mutation away from the ancestral allele is deemed to be recent!.

STRP D12S1344 and some genetic theory

Oota et al., 2004) [5] dug deeper in the geographic variation of these alleles. They included the short tandem repeat polymorphism (STRP) STRP D12S1344 and graphed the distribution of the 5-SNP haplotypes (the ones mentioned above: GCCTG, CGTCG, ACCTG, ATCTG, GCCTA) according to the STRP's alleles.

Let me explain this first (It took me some time to understand what they did and its implications), below is some theory.

STRP stands for Short Tandem Repeat Polymorphism.

The DNA sequence of different people varies in some parts of our chromosomes. These variations are known as "Polymorphisms". There are some special kinds of polymorphisms known as "Short Tandem Repeats", which are interesting for the study of genetics, so the study of these STRPs is important.

Four nucleotides: guanine (G), adenine (A), thymine (T), and cytosine (C) make up the nucleic acid of DNA.

STRPs are relatively short sequences of DNA (hence the "Short" part of the name"), comprising between 2 and 5 base pairs that are repeated (hence the "Repeat" part of the name) one after the other in "Tandem". The result is a sequence of the repeated unit. In the case of STRP D12S1344, the repeat is a two base pair (therefore, a dinucleotide), "CA" (cytosine and adenine) which is repeated n times. For instance: "CACACACACA" is a 10 bp sequence of a 5 tandem repeat of the dinucleotide "CA".

Since different individuals carry different repeat numbers, these are "polymorphisms" that differentiate one person from the next: for instance: One individual may have 5 repeats, the other 6, and yet another 8. These repeats arose from mutations in their ancestors.

STRs are usually considered “junk DNA” because they are introns and do not code for protein, changes in them do not affect the people carrying them. They are neutral to the forces of natural selection.

In the case of our STRP D12S1344, it was chosen because it is downstream of the ALDH2 gene locus. This STRP was "typed" (that is, it was sequenced) and its repeats were found to vary between 11 and 25 among all humans. These represent different polymorphisms. And each different repeat value indicates a different allele. These were given names: for repeats n=11 the allele was named "allele 222", n=12 was named "allele 224" and so on, until n=25 which was named "allele 250". [7]

By "repeat" we mean exactly that; so in allele 222, the "CA" dinucleotide is repeated eleven times. Below we see the eleven repeats flanked by the remaining sequence common to all humans:

... TCGTTTTCTGGGATACACACACACACACACACACACA TTCTGTCCTTCTTTT...

What causes the appearance of different polymorphisms in a given population? (Why does Joe have n=14, Jane have n=22 and Wang have n=15?).

They arise due to chance mutations that happen at a very low rates: between 1:100 and 1:1,000,000 per generation. [6]

They are mostly formed due to "replication slippage", whereby the DNA strands are mismatched during DNA replication and a repeat is added (or removed) from the resulting duplicate.

Since slippage is a symmetrical process, repeats are added and also removed. The outcome is that new alleles with a higher number of repeats are added and others are lost by removal.

Nevertheless, they are, in general, conserved over long evolutionary time spans and it seems that long repeats tend to shorten while short ones lengthen [6] even though insertions might tend to be self-accelerating and grow as the probability of a future mispairing increases.

Since natural selection operates on other parts of our DNA (those that code proteins), but not on the "junk DNA " of STRPs, the origin and evolution of different frequencies of repeats is due to chances (which adds or removes repeats), also to selection operating on the coding part of DNA and finally from the admixture with other populations having a different repeat mix in their genes.

We can imagine a group of people sharing a certain coding DNA due to their common ancestry and also the same repeat in an STRP. Should selection select against or for the trait coded by that DNA, then the STRP would be favored or disadvantaged because it shares the fate of the evolutionary pressures on the DNA it is piggy-backing on.

So there are three factors that interplay in the repeat alleles: chance, selection and admixture.

STRP D12S1344 continued

When comparing the STRP among different human groups, Oota et al., (2004) [5] found the following distribution of alleles (remember, the x axis indicates the number of repeats 222 is n=11 and 250 is n=25). The color depicts the relative frequencies of the 5-SNP haplotypes (the ones mentioned above: GCCTG, CGTCG, ACCTG, ATCTG, GCCTA) for each repeat allele. The number beside each region is the amount of populations sampled (yes, South America is always under-sampled, only three populations were considered: Karitiana, Surui and Ticuna [7]):

ALDH-2 5-SNP haplotypes of each repeat Allele at STRP D12S1344. Adapted from Fig. 4 Oota et al., [5]

So, what does it mean?

Let's take a look at it with a regional perspective:

• Africa, as expected, has a predominance of the Ancestral alleles (in black). The frequency histogram has a bimodal distribution with two clusters, one between 226 and 230, the other from 234 to 250. With the highest values at 238 and 240. In total, 12 alleles.
  There is a touch of GCTCG (pale blue) and similar amount of ACCTG (green), both widely spread.
  No "Asian" GCCTA (red), a clear indication of its East Asian origin.
  Very little ATCTG, (violet), at allele 236.
• Following the imagined tracks of an Out of Africa migration, we can see the shared traits of both South Western Asia (it has 11 alleles) and Europe (ten alleles), which are the closest to Africa.
  We see, with surpirse how the ancestral (black) lineage is virtually gone.
  The prevalence of ATCTG (violet), in contrast with Africa, and a similar content of GCTCG or (Blue). ACCTG (green) is also similar to Africa.
  The prevalence of repeat 240 has decreased and repeat 236 has grown to a similar frequency as 240. While the second "peak" at 226-230 is still there.
• East Asia, with is peculiar mutation, maintains a very high proportion of the ancestral lineage, though it has lost some longer repeats (246 to 250). It kept the second the peak at 226-230.
  It also mantains a predominance of the 240 and 238 repeat like Africa, and it is there that the GCCTA, Asian mutation (in red) appears.
  Repeat 240 reached a +50% frequency, fifty percent higher than the 30% frequency of this repeat found in other regions. Nine alleles are found in this region.
• Siberia. Not graphed by Oota. The Siberian Yakut, [7] are quite unlike the North and South American natives: they have a maximum of 42.2% at repeat 226. The highest in the World for this allele. Are these the ancestors of the Amerindians? It seems unlikely
• North America. The histogram shifts to the right: 242 and 244 repeats grow considerably:15% frequency at 244. The second "peak" at 226-230 still appears.
  The ATCTG, (violet) allele is found in much higer frequencies than in East Asia or Africa, but lowe than S.W. Asia and Europe. And the ancestral allele is also found at high frequencies, higher than S.W. Asia and Europe, but lower than East Asia or Africa. There are 9 alleles in this region.
• South America. The "second peak" has disappeared (226-230 repeats). And also, there is an increase of higer repeat frequencies, even more than those found in North America: there is a peak at repeat 244 of 25%, highest globally (mostly ATCTG - violet), and also at 238 with 20%, also a global high.
  The ancestral (black) allele is lower than N. America, East Asia and Africa. Only 7 alleles are present in this region.
  South America has the "two pronged" high frequencies on the right side of the histogram, just like Europe and S.W. Asia. All other regions have only one maximum on the right side.

Neanderthal admixture?

Since non-Africans admixed with Neanderthals, you might expect that the characteristic alleles of Neanderthals would appear in humans. I have not found any paper regarding this to be able to quantify it.

Nevertheless, the signal should be there. The sharp difference between European and S.W. Asian alleles on one side and the Asian, African and North American on the other is noticeable. The former have a one prong maximum at 240 while the latter have a two prong maximum in that area.

To me this spells "Admixture": mixing of two populations makes certain frequencies grow: those in which both populations overlap will grow, where no overlap exists, the frequency will decline. The exact amounts depend on the histograms of each population and the admixture ratio. I will do some simple simulations in part 2 of this post.

The double prong maxima is basically made up of ATCTG, the violet color mallele. Could this be a Neanderthal allele?

The Native Americans in South America have lost part of their alleles (the second peak centered on 226): perhaps due to a bottleneck in the population as it moved into South America, or maybe even later, 500 years BP, during the conquest, when millions of natives died due to disease brought by the European conquerors.

The alleles that did survive were those shared with Europeans (ATCTG, violet) -which may even be of Neanderthal origin- perhaps because they were related to coding areas common to Europeans and therefore granting protection against disease brought by them to America.

At repeat 240, compared to North America, the ancestral allele decreased at the expense of a growth in the ATCTG - violet one.

ACCTG (green) also survived, in lower frequencies than in North America and, again, at those frequencies common to Europeans: 236 to 242.

I wonder what would the DNA sequences of prehispanic natives show? Was the repeat diversity richer? Did they (and in this I include North American Natives), have a wider dispersion? Other haplotypes now extinct?

Continued in Part 2...

Sources

[1] Hui Li, et al., (2007). Geographically Separate Increases in the Frequency of the Derived ADH1B*47His Allele in Eastern and Western Asia. Am. J. Hum. Genet. 2007;81:842–846. DOI: 10.1086/521201
[2] Carrigan, M. A., et al., (2012). The Natural History of Class I Primate Alcohol Dehydrogenases Includes Gene Duplication, Gene Loss, and Gene Conversion. 7, s.l. : PLoS ONE, 2012, Vol. 7.
[3] Huai-Rong Luo, (2009). Origin and dispersal of atypical aldehyde dehydrogenase ALDH2*487Lys. Gene 435 (2009) 96–103
[4] Raymond J. Peterson, David Goldman and Jeffrey C. Long, (1999). Effects of Worldwide Population Subdivision on ALDH2 Linkage Disequilibrium. doi:10.1101/gr.9.9.844 Genome Res. 1999. 9: 844-852
[5] Oota,H., Pakstis, A.J., Bonne-Tamir, B.,Goldman,D., Grigorenko, E., Kajuna, S.L., Karoma,N.J., Kungulilo, S., Lu, R.B.,Odunsi, K.,Okonofua, F., Zhukova,O.V., Kidd, J.R., Kidd, K.K., (2004). The evolution and population genetics of the ALDH2 locus: random genetic drift, selection, and low levels of recombination. Ann. Hum. Genet. 68, 93–109. doi: 10.1046/j.1529-8817.2003.00060.x
[6] Christian Schlötterer, (2000). Evolutionary dynamics of microsatellite DNA. Chromosoma, September 2000, Volume 109, Issue 6, pp 365-371
[7] The allele frequency database ALFRED

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall © 

Ameghino and the Tertiary Man. Part 1.

Argentine naturalist Florentino Ameghino (1854 -1911), was a self-taught scientist. He was a school teacher who learned French. He taught himself paleonthology, inspired by the discoverys of Francisco Muñiz (1795 - 1871) who unearthed glyptodons, mastodons and horses at Lujan, Ameghino's home town. Muñiz was Argentina's first paleonthologist.

At an early date he began developing his most controversial theory, the authoctonous origin of man in America, which he put forth in his book La antiguedad del hombre en América in 1875, (The antiquity of man in America). Followed by The Quaternary man in the Pampa (1876).

In 1886, he worked briefly with Francisco P. Moreno as Secretary and Sub-Director of the La Plata Museum but their disagreement on several issues led to a life-long enmity. Moreno was the leading local scientist (also a self-taugh academic), who played an important role in the peaceful settlment of the border conflict between Argentina and Chile.

Florentino Ameghino

He travelled to Europe and deepened his knowledge in anthropology and geology, returning to Argentina where he was Director of the Natural History Museum (1902).

With the help of his brother Carlos he collected a large number of fossils, discovering hundreds of new species. He laid down the foundations of Argentine geology with his stratigraphic classification.

He uncovered remains of masupials, monkeys and paleoindians. He believed that the Mylodon was alive somewhere in Patagonia after the discovery of some apparently recent remains (later dated to 10,832 and 12,984 years BP) in 1895.

Between 1902 and 1911 he was Director of the Buenos Aires National Museum. Together with his brother Carlos he secured a large collection of Patagonian fossils and transformed South American geological studies.

Tertiary Man in America

Ameghino made some discoveries in Monte Hermoso, in 1887, on the southern seabord of Buenos Aires province. He attributed crude flints, burned earth and a human vertebrae to a "Tertiary man". The bone was discovered in the Monte Hermosan formation of Pliocene origin, 3.5 My old. This was quite controversial, but he received support from his European colleagues.

Ales Hrdlicka, an anthropologist at the Smithsonian Institution (U.S.), was actively against the idea of an early presence of man in the Americas and came to Argentina to meet Ameghino in 1910. His purpose: to discredit the findings.

He visited the site and though he judged the Monte Hermoso remains to be those of a modern man, he focused his criticism on other discoveries made by Ameghino in a later formation, the Puelchean, about 1.5 My old.

He focused on the fact that the tools (quite primitive in their appearance), were recent and not ancient. This was because they were found in the uppermost layers of the Puelchean formation. So even though the sediments were Pliocene, he argued that those containing the tools were separated from the older ones by an unconformity, and therefore recent, made by Native American Indians.

Ameghino also reported stone tools found in other older formations (Santacrucian and Entrerrean formations) some 15 to 25 My old. These findings are indeed questionable.

After Florentino's death, his brogher Carlos kept on digging, and made a discovery in Miramar, Buenos Aires, in the Chapadmalal formation of Pliocene age. It was also disputed by Hrdlicka. A commission was sent to investigate the site (1914), and corroborated the digging practices in these sediments backing Carlos.

A Toxodon bone with an arrow head was found in these layers, (see my post on this discovery: H. erectus in Argentina), but critics attributed it to a more recent date: young remains that moved down, into older sediments. However Carlos contended that even though Toxodons lived in the Pampas until some 10 kya, this bone belonged to a primitive variety of Pliocene Toxodons.

He believed that the arrow-head was of Mousterian technology and was at least 3 million years old.

Hrldicka was against this idea and, of course, refuted it: In 1918, Antonio Romero contended that the remains had been removed from recent layers and deposited under older ones due to bed shifting and layer mixing.

Hrldicka's point of view prevailed, the authoctonous origin of humans in America was ridiculed and forgotten. Instead, Man arrived in America from the Old World by crossing the Beringian land bridge not more than 15 kya. This is the theory that stands until today.

But, lets take a look at Florentino Ameghino's discoveries regarding stone tools that resemble Acheulean axes.

To be continued

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall © 

Ameghino and the Tertiary Man. Part 2.

Continuing with Florentino Ameghino (see previous post) and his theory of a Tertiary man in America, one that originated in the Americas and spread from there to the rests of the world, in today's post we will take a look at the stone tools that have a distinct "ancient" lithic technology look.

Ameghino does not hesitate to label the tools he discovers as "Mousterian" or "Acheulean", he is convinced that they are really old tools, tools not made by modern humans.

Bifacial spear point. Mousterian

He found what he calls "spear points" and states that "All the ones that we have, belong to the Moustier type, and until now we have only found one specimen crafted on both sides, which regrettably we lost the same day that we found it. It was of a great size and almond shaped, chiselled with great care on all its surface. [1]

He notes that the arrow heads (smaller than the spear points) are much neater than the Moustier points and says, regarding spears, the following:

"The face is fashioned with large blows and only are the edges fashioned with some care.
The most common shape is shown in figures 54 and 56, leaf shaped and knapped with strong blows...[1]

Mousterian spear point from arroyo Frías, Buenos Aires. Fig. 54, From [1]

Axe, Acehulean

Ameghino also mentions axes. He recognizes that they are "extremely rare, and cites one, resembling an Acheulean axe, found by a Jesuit missionary in the hills at Tandil, 350 km southwest of Buenos Aires:

"of common cuartz, thick bodied, pointed, ovoidal and approaching the Saint-Acehul, 125 milimeters long, a maximum width of 70 and 20 thick.
Personally we have found several quartz stones [...] the largest is shown in figure 117, found on the shores of cañada Rocha. It is the exact reproduction of a variety of Quaternary European axe, known as Moustier. It is made of quartz, elongated oval shape and knapped on one face. The worked face is convex and chiselled with care on all its surface, but especially its edges, which are chipped with small blows. It is well sharpened, especially on both of its tips [...] it is 65 milimeters long, 29 wide and 11 thick in its thickest part, the central one." [1]

Mousterian tool, from cañada Rocha, Buenos Aires. Fig. 117, From [1]

Axe, unifacial and bifacial, Mousterian

Besides the few "axes" from Buenos Aires mentioned above, he mentions others discovered in Uruguay, some of which are "worked on one side". These are not biface axes, they are "unifacial" (perhaps used as scrapers).

"Apart from these axes worked on only one face, there are others, shorter and not so thick, with a wider, rounded base, which also end in a pretty pointed tip, very similar in their outline to the triangular axe found in the Moustier cave, drawn by Hamy in his «Paléontologie Humaine» [...]
The best specimen we found is shown in figure 300, it is 152 milimeters long, 134 in its widest part and 58 in its thickest. A large part of its edge is shaped with concoidal blows, in particular its upper tip, which has been knapped and thinned so that it can be easily gripped.
Axes worked on both faces are not so numerous as the others. The most notable one we have, is oval shaped, convex on both facces and shaped with heavy blows on all of its surface [...] This instrument is depicted in fig. 289, it is shaped in such a way that it has a cutting edge all along its border, produced by many concoidal blows, applied in an oblique manner on one side and the other side of the edge. The surface of the stone has several concoideal depressions with a very flat bottom, the outcome of having removed, with blows, great pieces of stone. It is 19 centimeters long, 12 wide and 8 thick in its thickest part, and it ways 57 ounces... [1]

Mousterian axe, Uruguay. Fig. 300, From [1]

Mousterian axe, Uruguay. Fig. 289, From [1]

Leaving Ameghino for the time being, below is another image, this one corresponding to a hand axe found in Montevideo, Uruguay, at the small hill that overlooks the town, (Cerro de Montevideo), at Punta del Tigre. It is part of the Museo Nacional de Antropología museum. It is a rather coarse looking axe. [2]

Hand Axe from Montevideo, Uruguay. From [2]

He believed these tools were the work of humans that had originated in America. He devised a hypothetical evolutionary chain, from the most primitive hominin to the most advanced ones. A chain built on feeble links, since the remains of some of these creatures were never found. In a previous post I mentioned the "Diprothomo" skull found during the building of Buenos Aires port, Ameghino believed that it belonged to one of his hypothetical hominids (Diprothomo). But this will be the subject of another post.

To be continued.

Sources

[1] Ameghino, F., and C., (1918). La antigüedad del hombre en el Plata ... Texto de la edición oficial, dirigida por A.J. Torcelli bajo la dirección de Carlos Ameghino pp. 132 and 222
[2] Citrino.Blogspot

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall © 

Seals that live in freshwater

Florian Paucke (1719 - 1780) was a Jesuit missionary, born in Bohemia. He spent almost twenty years among the Mocoví natives in the missions of Paraguay between 1749 and 1767, when the Spanish crown siezed the properties of the Jesuit Order and deported its members back to Europe.

Paucke depicted the daily scenes of his mission, the natives and the animals of the surrounding regin in a series of naive watercolors. One of his paintings is reproduced below. It shows a group of natives hunting capivara or carpincho with spears. Around the border of the painting it also shows some aquatic riverine mammals:

Animals painted by R. Paucke late XVIII century. Paraguay.

During his stay in Southern South America, he encountered different creatures: Carpinchos, jaguars and, as shown in the image above, a very strange seal (red arrow).

Besides painting them, he wrote a book, "From here to there: a stay among the Mocoví Indians (1749-1767)" from which we took the following quote, describing an island on the Paraná River:

"On this tiny island there were many tigers [jaguars] , deer, wild pigs, ostriches [ñandu - Rhea], venison, leopards, [ocelote or Leopardus pardalis mitis] sea wolves and sea pigs (carpinchos) in large quantities....". [1]

He depicted one of the sea wolves, upper central part of the image above. Marked with a red arrow.

The caption above the creature reads: "Sea Wolf, Lobo Marino, enelaviagei ?". In German or English, Spanish and Mocoví ? respectively.

The words Sea and Marino, which is the Spanish word for "belonging to the sea" clearly identify this creature as a sea faring animal. Which is surprising since Paraguay is several hundred kilometers from the sea. The description of a Carpincho as a "Sea Pig" is also surprising since this is definitively a fresh water animal.

Taking a closer look at the "sea wolf", it appears to be very otter-like, with a long slim bushy tail, claws (no webbing between its toes), short ears and short snout. Yet it does not stand up on its legs, it lies on its belly, in a seal-like manner. Quite intriguing indeed!

The Paraná River was home to all the animals that he mentioned in his text, except for the "sea wolves". There were what the Spaniards called Lobitos de río, that is "Tiny River Wolves", which are otters. But he clearly states that they were sea going animals, perhaps implying that they were not otters, but seals.

The larger River wolves were the White-chested Otter (Lutra brasiliensis), the biggest otter in the world, currently found in the Amazon River basin, whose range in the past included the River Plate basin. [3]

But Sea wolf is the Spanish name for a type of seal, not an otter.

Paucke must have surely seen seals and sea wolves when he reached South America, on the islands at the entrance to the River Plate, in an estuarine salt - fresh water area. Even today they can be found on the rocks close to Cabo Polonio, Santa María and Punta del Este, in Uruguay. They may have been more abundant in the 1700s.

But what about the region further upstream, along the Parana and Uruguay Rivers, that flow into the River Plate?

Seals in the River Plate basin

I found a reference that states that phocidae and otariidae (seals) swam upstream along the Parana and Uruguay Rivers [2].

Another reference comes from Spanish naturalist Félix de Azara (1801) who mentions a river over 700 km (435 mi) from the sea, which flows into the Paraná River, as having "sea wolves":

"The Corrientes river is large and bigger than the Guayquiraró: it has sands and breeds many sea wolves, stingrays that sting with cruelty, yacarés [a South American croc] and many other fish." [4]

Sea Wolves are even mentioned in landlocked Salta province, over 1,300 km (800 mi) from Buenos Aires and the sea. Naturalist Holmberg cites Stuar who, in 1878, saw "Sea and river wolves" [5] in Salta. This should not be surprising since the Pilcomayo, Bermejo, Juramento rivers, which flow into the Paraguay and Paraná rivers, reach the Andean foothills in Salta. All of these rivers are part of the River Plate Basin. Seals could, in theory, swim upstream along any of them.

Sources

[1] Florian Paucke. Hacia allá y para acá: (una estada entre los indios Mocobíes, 1749-1767). Vol. 2. pp. 41. Editorial Nuevo Siglo, 2000.
[2] Anales de la Sociedad Científica Argentina, Volumes 127-128. 1939 pp. 295
[3]O. V. Aplin, (1894) Field-Notes on the Mammals of Uruguay. Zoological Society of London
[4] Félix de Azara, (1801). Memorias sobre el estado rural del Rio de la Plata en 1801: Demarcacion ..... Sanchiz, 1847. pp. 34
[5] Claudio Bertonatti, (1994). Los que se van: especies argentinas en peligro. Editorial Albatros, pp. 244.

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall © 

On Acheulean hand axes in America

Biface hand axes are a clear indication of primitive hominin presence in a given area. These stone tools have been in use for over 2.6 Million years, the longest-used tools of mankind.

Modern use (i.e. roughly since 20 kya) has been more limited since H. sapiens developed better lithic technologies which relegated the hand axe to some very specific uses in certain parts of the world.

Today's post looks into the following hypothesis: Since primitive humans did not have the knowhow to make advanced tools. If these "primitive" tools are found in a context where "more advanced" toolage is absent, it means that we have found an "archaic" human site.

In the Old World, these tools are associated with many pre-sapiens hominids (H. habilis, H. erectus and Neanderthals), and when they are found, the presence of these humans is accepted without any questions. However, when they are found in America... things are different.

I wrote a brief post on this subject (Ancient Bifacial tools in Argentina), but decided to expand it. Today's post is the outcome:

The hand-axe

First, let's take a look at the biface hand-axe.

The hand axe is a simple artifact it is a flint or obsidian pebble which has been shaped into a two-faced (hence its name, bifacial), almond shaped core by pressure or percussion knapping on its original surface to remove stone flakes (more on this below). They were the first prehistoric man-made tools to be recognized as such, though it was not clear what they were used for.

Its shape (axe-like) gave the impression that it was manufactued to be used as that, a primitive, coarse axe, to chop, cut, tear, dig for tubers, bugs and small animals. While ohers believe that it was thrown at prey to stun or kill them.

We may never know for sure what its exact purpose was. It may have had symbolic or religious connnotations too.

More on the hand-axe

These axes have a longitudinal axis symmetry with a pointed tip and a rounded base (that is why they are called axes), the round area is believed to have been the part which fit into the palm of the hand of the user.

The oldest ones date back to 2.6 mya (and even earlier), and were found in Ethiopia, they are known as "Oldowan" tools, and were made by Homo habilis, the first hominid tool-makers. [1]

The hand-axe technology remained in use for millions of years and evolved into Acheulean toolage 1.4 mya (of H. erectus and later Neanderthal) and Mousterian tools of the Neanderthals.

See some real Neanderthal axes here, these are from Eurasia. Below you will see others, from America, supposedly made by modern humans.

At its height some 200 - 125 kya. Later, during the Middle Paleolithic, it was found all across Africa, Europe and Asia, even in Southern Asia, where previously it was believed to have been absent -bamboo tools were believed to have been used there instead of stone ones (The "Movius Line" marked the limit of the Acheulean tools of Western Asia).

With the appearance of modern humans, it declined and during the last glacial period became quite infrequent.

It has also been found in America, together with Folsom and Clovis lithic technologies and also, in other context. It is said that it is virtually unknown in Australia [1], but that is not the case: large bifacial axes were used by Aboriginals until recently in ritual combats and by women, to dig roots and yams and date back to 34 kya. [12]

Let's take a closer look at the Americas:

The "Late" peopling of America

Despite being quite infrequent after the Last Ice Age, it is found in America, which was peopled precisely after the Last Ice Age (according to orthodoxy). Why is this so? Primitive tool among modern H. sapiens hunters in America?

To work around the obvious incongruity of a "primitive" axe in the context of modern Neolithic tools, the American archaeologists came up with a novel theory:

Based on the fact that to shape it, it had to be knapped and flint flakes were produced; they assumed that it was used as a blank, portable source for fresh flint tools: carried around by the hunter groups, and knapped when needed in sites where no suitable raw materials could be found to fashion stone tools from it.

The core with a hand-axe shape, was just a source of other tools.

This notion has permeated American archaeology. Below are some examples:

Venezuela

Hand axes and "cores" were found in 1980 at the Terraza de El Cayude iste (11° 48’ 024" N, 69&deG; 56’ 621" W.), close to Sant Ana, Venezuela. Because they have been found associated to Clovis tools in North America, they were described as "Clovisoid" tools and of course, the Clovis comparison put a limit to the antiquity of these tools: they were assigned an age of 8 to 11 kya. Below are to images of these tools: [6]

Bifacial Chert axe. [6]

amigdaloid bifacial artifacts. [6]

They do look rather primitive to me. Since they were not dated directly, they could even be quite old. They surface as erosion wears the soil away, exposing them.

The authors quickly identified them as axes yet, were struck by the rigid orthodoxy imposed by the Clovis peopling supporters and embraced the notion too: [6]

"We were surprised that in the excellent book by Anthony T. Boldurian and John L. Cotter: Clovis Revisited published in 1999, they do not refer to them as axes. They display the drawing of a very beautiful axe and catalogue it as a "portable bifacial core" which hunters transported to remote locations, where they hunted, far from any source of raw material. And, if they needed a knife or a spear point, they could use the portable core to obtain it. They added: 'and if they did not need it, they could bury it or store it inside the territory for future use'. (Boldurian & Cotter, 109; 1999. Free translation)." [6]

They went on to add that they believed that the five cores they found which were not bifacial aces, were used as a source for raw material for other tools. They describe the axes as being 18 cm long, 14 cm wide, 1.8 cm thick and weighing 600 g, (7 in, 5.5 in, 0.7 in, 1.3 lb.), and assumed that they were used for butchering their megafaunal prey.

Mexico

Harami Fujita describes axes found at the El Pulguero site, 25 km northeast of La Paz, in front of the Espíritu Santo Island, Baja California Sur, Mexico. [2][3]

Below are two images of these axes:

Axe Preform, El Pulguero. From: [3]

Biface, El Pulguero. From: [2]

The site is a "quarry", not a settlement or a temporary camp, it is the place where the stones were quarried between A.D. 1000 and 1700. Yet the region has been occupied at least since 8,000 kya.

Fujita calls the hand-axes "preforms". Plenty were found (78 in total), measuring on average 18.5 cm long, 9,2 cm wide and 4,2 cm thick (7.3 in, 3.6 in, 1.7 in).

She writes that there is "lack evidence of final biface work. No retouch marks by pressure were observed in these preforms..." [3]. And adds:

"The end use of bifacial preforms of El Pulguero is not resolved yet. We do not have sufficient evidence which indicates the function of these artifacts. However, these artifacts could have been used to cut specific plants to make wood and bone objects, including rafts, paddles, dart-throwers, harpoons, spears, ceremonial boards, awls, spatulas, and cooking implements [...] The final stages of tool manufacture and use occurred in other places. We think that bifacial performs were much easier to transport farther than the raw material. The lack of finished elongated bifaces and pressure work on the edges of these artifacts support this interpretation... [3]

Since they are lying on the surface dating is uncertain, they may be much older than inferred by Fujita (more on this below). Furthermore the lack of sharp retouch edges could be due to erosion over a long period of time. These tools look old and are coarse because they were made by less skilled hominids than modern humans.

What Fujita does not address is why would these "preforms" be left behind, at the quarry. Weren't they intended to be carried around as portable sources of new tools? [5]

Robert Gargett comments that: "from personal observation that Baja has plenty of similar 'Acheulean' archaeological occurrences" [4] and that he met other archaeologists at UC Berkely, (Garniss Curtis, Carl Swisher, Don Johanson and Bill Kimball) who "mentioned a tray of hand axes that had been collected in Baja California" [4].

U.S.A.

Hand Axes were found at Topper site, in S. Carolina, and the image below shows them [4]

"Preforms" from Topper Site, South Carolina. Source [4], citing [9]

There is another site, G. S. Lewis- East, along the Savannah River, also in S. Carolina. [11]. Which has what is referred to as "biface preforms" of Kirk period some 9,000 rcybp. But the way that these preforms can be turned into other tools is not very clear [4].

These sites described above are all very "recent" and none is older than 11 kya. All are assigned to modern Neolithic humans. But why would they and not their Eurasian counterparts be the only H. sapiens to carry around "preforms" with them?

The "Acheulean-in-the-Old-World" Bias

When discussing Fujitas findings at El Pulguero I mentioned that they were superficial findings and dating was uncertain, they could be in fact much older than inferred by her. Below is a similar point of view expressed about South East Asian Acheulean bifacial tools which were not recognised as such: [7] (bold mine)

"It is traditionally argued by proponents of the Movius Line that ‘true’ Acheulean bifaces, especially handaxes, are only found in abundance in Africa and western Eurasia, whereas in eastern Asia, in front of the ‘line’, these implements are rare or absent altogether..."
.... in Southeast Asia and elsewhere in the Far East, where bifaces are common as undated surface finds but, lacking a dated context, are routinely considered products of modern human cultures. Dating African and western Eurasian surface finds as Acheulean while dismissing similar Southeast Asian and Far Eastern artefacts is a case of shifting the goalposts, one that potentially distorts Acheulean evidence in the Palaeolithic Old World..." [7]

The above is, in my opinion, valid for America: Acheulean tools are not recognised as such when found in the New World. Instead they are interpreted as "preforms" or "bifacial blanks" made by modern Neolithic humans.

That is what Ebert (1992:78, [10]) did, when he reclassified some evidently Acheulean tools found in Green River Valley, Wyoming, as blanks or preforms for other tools.

However, a close look at some of these tools, as depicted by the first European to see them, William A. Jones in 1873, is quite interesting, they have in my opinion, a "Levalloisian" appearance, which is a clear Neanderthal hallmark:

Levallois stone tools are made by flaking the flint stone to shape it like a tortoise shell (which is what I see in the image below). The Neanderthals developed this technology about 250 kya and it evolved into the Mousterian technology some 100 kya.

Two different tools from Green River, From. [8].

The Green River basin tools were assumed to be recent even though Jones remarked that the contemporary Indians had no knowledge about who made them, a clear indication of an ancient origin.

Of course some of these tools were found close to other more modern tools. But, I believe that since nobody is actually looking for a Neanderthal-made tool in America, they will always be classified as made by H. sapiens. No one really bothers to verify their antiquity (that is +40 kya) and they are always taken as being some 10 kya!.

Sources

[1] Boyd, Robert (2008). How Humans Evolved. New York: W. W. Norton & Company
[2] Harami Fujita and Gema Poyatos de Paz, (2008). Prehistoric Quarrying and stone tool production at El Pulguero, Baja California sur, Mexico. Pacific Coast Archaeological Society Quarterly, 39 (2 & 3)
[3] Harami Fujita, (2009). Rhyolite bifacial preform production at El Pulguero a prehistoric Quarry and workshop site in the Cape region of Baja California. SCA Proceedings, Volume 22 (2009).
[4] Gargett, Robert H. Saturday, 19 January 2013, More North American 'Hand Axes'. The Subversive Archaeologist is licensed under a Creative Commons Attribution-NoDerivs 3.0 Unported License.
[5] op cit. Friday, 18 January 2013. And The Winner Is... Biface!
[6] Miklos Szabadics Roka, (2010), Puntas Clovis en Venezuela. Cazadores especializados Clovis en Paraguaná, Edo Falcón Venezuela.
[7] Brumm, A. & Moore, M. W. (2012). Biface distributions and the Movius Line: A Southeast Asian perspective. Australian Archaeology, (74), 32-46.
[8] Jones William Albert et alReport upon the reconnaissance of northwestern Wyoming, including Yellowstone national park, made in the summer of 1873. pp. 260.
[9] Ashley M. Smallwood, (2010). Clovis biface technology at the Topper site, South Carolina: evidence for variation and technological flexibility. Journal of Archaeological Science 37:2413-2425
[10] Ebert, J.I., (1992). Distributional Archaeology. Albuquerque: University of New Mexico Press.
[11] Kenneth E. Sassaman, Randy Daniel and Christopher R. Moore, (2002). G.S. Lewis-East: Early and Late Archaic Occupations Along the Savannah River, Aiken County, South Carolina. South Carolina Institute of Archaeology and Anthropology, University of South Carolina.
[12] Mark W. Moore, (2003). Australian Aboriginal biface reduction techniques on the Georgina River, Camooweal, Queensland. Australian Archaeology, Number 56, 2003

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall © 

Neanderthals, fat and the peopling of America

Two recent papers on Neanderthals may have some relevance regarding the peopling of America. Although neither one of them deal with Amerindians (studies on Modern Human - Nenderthal gene comparisons tend to ignore Native Americans and only focus on Africans, Asians and Europeans!), they do shed some light on them too:

On Admixture between us and them

The first paper (Lohse and Frantz, 2014) [1], looks into the admixture issue, which some (Eriksson & Manica, 2012) [2], have put in doubt by considering that the signal of archaic genes found in Neanderthals and Modern Humans does not mean an actual physical introgression, instead it is just the genes that both groups inherited from a common ancestor in Africa, and are therefored shared by both groups without any "intercourse" necessary between them.

Lohse and Frantz prove that admixture took place out of Africa, after the modern Humans began their expansion out of Africa.

They estimate divergence between Neanderthals and H. sapiens as having taken place between 329 and 349 kya, and the split between humans that remained in Africa and those that left at 122 -141 kya.

Interbreeding took place out of Africa and resulted in a slightly higher proportion (fraction) of Neanderthal admixture in modern East Asians (Han Chinese) in comparison to Europeans:

• 5.9% admixture in CHB (Chinese Han in Beijing) [3.9% to 7.9%].
• 5.3% admixture in CEU (Europeans) [3.4% to 7.3%].

This figure of between 3.4 and 7.9% admixture is higher than those disclosed by previous studies (1 - 6% such as Green et al., 2010) [4].

Also, and this is interesting, the Time of admixture is estimated as having taken place between 37 and 86 kya., with the following values:

• 75.8 ky for CHB (Asians)
• 55.1 ky for CEU (Europeans)

This means that the Neanderthals encountered the Asians first, mixed with them, leaving a higher proportion of their genes in them. And later mixed with humans in Europe in a lower proportion.

Fatty metabolism

The admixture figures are ratified by another paper (Khrameeva et al., 2014) [3], which looked into lipid catabolism in modern humans and its Neanderthal origin as well as its predominance in Europeans.

They calculated the D statistic (fraction of Neanderthal-like sites, or NLS), which showed a higher admixutre in Asians compared to Europeans:

"reflect[s] relative similarity between the Neanderthal and the modern human genomes tested, they do not provide a quantitative estimate of Neanderthal ancestry, that is, a 5% D-statistic value reflects a higher similarity between population A and Neanderthal compared with that for population B, but does not signify a 5% level of Neanderthal ancestry in the population A genome.
[...]
there was no substantial difference in the genome-wide frequencies of NLS between European and Asian populations, with a slight tendency for higher frequencies in Asians: 5.9±0.08 and 6.2±0.06%, respectively." [3]

They pointed out that the lipid (fat) catabolism has organic implications and mention seven metabolic categories associated with LCP (2-lysophosphatidylcholine) among which is "glucose-dependent insulin secretion [...] These observations support a contribution of Neanderthal genetic variants to the phenotype of contemporary Europeans." [3].

This ties in with another paper [5] which shows that a risk gene known as SLC16A11, found at very high frequencies among Native Americans, causes Type 2 diabetes, by changing levels of the protein that the gene encodes which alters the amount of a specific type of fat (lipid) which other studies have linked to the risk of diabetes. This gene is of Neanderthal origin.

According to this paper [5] :"SLC16A11; it is present at ~50% frequency in Native American samples and ~10% in east Asian, but is rare in European and African samples. Analysis of an archaic genome sequence indicated that the risk haplotype introgressed into modern humans via admixture with Neanderthals."

Its prevalence is five times higher than among Asians! Maybe an indication of a strong Neanderthal introgression in Amerindians.

So we have a link between Amerindian diabetes and fat, caused by a gene of Neanderthal origin and Europeans who also have high levels of fats due to their Neanderthal genes. It is a pity that the recent study on lipids [23] and the one measuring introgression [1] did not sample Native Americans. I understand the reason following the orthodox viewpoint:

American Natives descend from Asian stock so they should have diluted Neanderthal genes compared to the Asians. But, what if... Neanderthals reached America first and mixed with H. sapiens there? Wouldn't Amerindians display (as they indeed do - with diabetes), a higher frequency of Neanderthal genetic traits? Could these have spilled back into Eurasia from America? I believe so:

The temporal gradient from East to West of admixture timing seems to imply this: early mixing in Asia, later in Europe. And also the proportion of Neanderthal genes: higher in Asia, closest to the point of admixture (America), lower as you move West, into Europe, where more modern humans watered the Neanderthal genes down.

We will keep on waiting for studies that include American Natives' data.

Sources

[1] Konrad Lohse and Laurent A. F. Frantz, (2014). Neandertal admixture in Eurasia confirmed by Maximum likelihood analysis of three genomes. Genetics: Early Online, published on February 13, 2014, doi: 10.1534/genetics.114.162396
[2] Eriksson, A. & Manica, A., (2012). Effect of ancient population structure on the degree of polymorphism shared between modern human populations and ancient hominins. PNAS, page doi: 10.1073/pnas.1200567109
[3] Ekaterina E. Khrameeva et al., (2014). Neanderthal ancestry drives evolution of lipid catabolism in contemporary Europeans. Nature Communications 5, Article number: 3584 doi:10.1038/ncomms4584 April 1, 2014
[4] Green, R.E., et al., (2010). A draft sequence of the Neanderthal genome. Science, 328(5979), 710–722.
[5] The SIGMA Type 2 Diabetes Consortium, (2013). Sequence variants in SLC16A11 are a common risk factor for type 2 diabetes in Mexico. Nature, DOI: 10.1038/nature12828

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall © 

Beringia the modern "Lemuria"

As orthodox science accepts as proven fact that the Americas were peopled by a very limited group of people in a rapid expansion that spanned the continent from Alaska to Tierra del Fuego in a few milennia, they are now building "proof" to support this notion.

The proof is known as the "Beringian standstill hypothesis". It involves a Twentyfirst century lost continent, which is not Atlantis (the mythical land that sunk in the Atlantic Ocean) but "Beringia", a rehash of the legendary continent of "Lemuria" or "Mu", which were invented as dry land stepping stones before plate tectonics correctly explained how trees and animals managed to cross vast oceans and people distant lands.

In a nutshell, a recent paper ("Out of Beringia?" [3]) elaborates on a theory originally suggested by Eric Hultén in 1937 [4]: that the Bering Strait land bridge was a refugia for tundra vegetation during the Ice Ages. The paper's authors, Hoffecker, Elias and O'Rourke contend that apart from tundra plants, Beringia was also "a glacial refugium and postglacial center of dispersal for the people who first settled the Americas" [3].

They believe that the ancestors of Amerindians split from their Asian relatives 25 kya, lived in Beringia for about 10,000 years and moved into America when the glaciers began melting and apart flooding Beringia, opened up the routes into the heart of America.

The 10 kya standstill arises because the distinct American Native mtDNA requires an isolation of several thousand years in isolation. The paper believes that it was possible because the tundra also supported some stunted trees (birch, adler, willow) which could have been used to ignite and burn megafaunal bones and give off plenty of heat. The land bridge also supported an edible fauna of mammoths, elk, moose and bison.

The New Lemuria

The lost continent of Lemuria or Mu.

Beringia during the last Ice Age. From [2]

The new Lemuria (or Beringian Standstill hypothesis) arises to be able to explain how the "American founding fathers", ancestral to all Native Americans, managed to mutate their Asian mtDNA into novel haplotypes, develop new alleles that were distinct from the original Asian stock and then disperse across America without any of these genetic traces remaining back in Asia.

The fact is that there are mtDNA haplogroups found exclusively in America but not in Asia (A2, B2, C1b, C1c, C1d, D1 and D4h3). This pan-american uniqueness also extends to Y chromosome haplogroup Q1a3a-M3 and to some privatee alleles (i.e. autosomal 9-repeat at the microsatellite locus D9S 1120).

If they are not found in Asia, then, the obvious and most parsimonious answer is that they originated in America, and dispersed across the continent, but no, orthodoxy does not accept this, and had to invent a "Moses-like" band of migrants wandering in the wilderness. But instead of 40 years, these people spent 10,000 years in their Beringian "Sinai" before reaching the "Promised Land" of America.

The justification for the "Standstill" is the following:

1. Large ice sheets blocked access into America until about 15,000 years ago.
2. An earlier date (i.e. older than 15 kya) for the peopling of America is not acceptable for orthodox science.
3. Modern humans are believed to have reached Eastern Asia 25,000 years ago, but did not move into America then (due to 1 and 2. above)
4. mtDNA had to diversify into American haplogroups, which takes time (10 ky is sufficient).
5. But diversification had to happen in isolation (to avoid any of it remaining in Asia).
6. The only place this could happen: in between Asia and America: Beringia.

So we imagine a vast land with cold but bearable climate, cut off from Asia and America by ice fields that could not be crossed by men. And a group of humans isolated there for 10 ky, until the Alaskan gateways opened (I wonder why the Siberian one reamained closed... The mechanism is not explained. But it is necessary to avoid any of those distinct genetic markers from going back into Asia). Of course, since the oldest Paleoindian sites acceptable for orthodoxy are about 15 kya, (some are in South America), so this means that the peopling of the continent had to take place super fast. This means that these people who sat around Beringia for 10,000 years suddenly rushed across the New World and settled it immediately.

The map below summarizes it (source: wikipedia).

This is a bit too far fetched for my liking.

The Second Wave

Then, after this initial wave of Paleoindians, a second wave marched across Beringia from Eastern Siberia: the ancestors of those bearing hablogroups A2a, A2b, D2a, D3 and X2a, which are found in the north of North America, which by the way have similarities with Eastern Asian groups and share common languages.

However, there is a problem with the language question see my post on American Languages), which another recent paper has also attributed to a "Beringian isolation" (it is in vogue now), but different from the one in the paper mentioned above.

This paper uses phylogenetic methods to support the theory that the American Na Dene and the SiberianYeniseian languages connection is very probably due to a "radiation out of Beringia with back-migration into central Asia than a migration from central or western Asia to North America". [1]

So here we have another group in Beringia that moves both back into Asia and ahead, into North America. Which is almost simultaneous with the one mentioned above! So why didn't the genes follow the languages back into Asia? Also, it argues for an older initial population of America (15-40 kya) which predates the one mentioned above. Please allow me to quote the paper extensively (bold is mine):

"DNA evidence supports at least three migrations with the earliest 15–40,000 BP referred to generically as the Paleoindian and associated with the greatest distribution of language and cultural groups across North, Meso, and South America; the second 12–14,000 BP is the Na-Dene distributed in North America from Alaska to the Pacific Northwest and from Canada to the U.S. Southwest; and the third ca. 9000 BP is Eskimo-Aleut with circumpolar distribution.
Linguists have classified Eskimo-Aleut and Na-Dene as separate language stocks, and the rest of the languages of the Americas as belonging to numerous stocks, but have otherwise been mostly silent on questions that connect Asian and the American populations because, with the exception of Eskimo-Aleut, the dates of these earlier connections lie beyond the traditionally accepted limit for comparative reconstruction.
Linguistic claims of more distant relationships have relied instead on the more controversial method of mass (or multilateral) comparison of lexical items subjectively judged as similar. Using such methods a Dene-Yeniseian (DY) connection linking Asia to North America has been suggested for nearly 100 years, but only recently has a stronger case been made using methods of linguistic reconstruction, which has been peer reviewed with cautious optimism urging alternative methods for its evaluation. The hypothesis of a DY language family prompted claims of proof for the origin of Native Americans in central or western Asia, the relationship fitting into a popular narrative for the peopling of the Americas.
[...]
Our results support an argument that, if the Dene-Yeniseian connection is true, it more likely reflects radiation out of Beringia with both eastward migrations into North America and westward migration into Asia rather than a unidirectional migration from Asia to North America." [1]

The language flow (and the people speaking them) is bidirectional, 12-14kya and only corresponds to North American Na-Dene natives, while the other paper covers a unidirectional flow (into America), across the whole continent, 15 kya.

The theories are in conflict and should be compatibilized.

Beringia

Let's take a look at the scene where these events took place:

The Beringian land bridge is currently submerged and only appeared when the glaciers accumulated enough water (as ice) to drop sea levels. This happened during the Ice Ages of the Pleistocene, and also earlier.

We know that it existed for about 10 ky between (roughly) 32 and 18 kya. It was narrow in its central part (current Bering Strait region) it was however wide at its oriental and occidental portions. It covered an area larger than the state of Texas [2].

The extreme dryness of the area did not allow snow to accumulate and build up glacers so it remained ice free, glaciation surrounded it, in the mountains in alaska and Siberia but not in the lowlands of Yukon, Alaska, Eastern Siberia and, of course, Beringia. These remained free of ice during the Pleistocene.

The period during which this "standstill" took place, the Last Glacial Maximum (LGM), was "relatively dry and cold with cooler summers" [2].

Closing Comments

Perhaps the refugium applies to the Na-Dene speakers, late arrivals to the continent. But the Paleoindians definitively reached America over 30 kya. Future findings and older sites will confirm this hunch.

Land Bridges formed across Bering Strait many times during the past 1,500,000 years and were contemporary to hominds who could have marched across them: H. erectus, Neanderthals and even archaic Modern Humans from Asia.

I am surprised at the persistence of notions such as "a late peopling of America" and patches to try to justify the holes in the theory instead of building a new one that explains all facts.

Sources

[1] Mark A. Sicoli and Gary Holton, (2014). Linguistic Phylogenies Support Back-Migration from Beringia to Asia. March 12, 2014DOI: 10.1371/journal.pone.0091722
[2] S A Elias and J Brigham-Grette, (2013). Late Pleistocene Glacial Events in Beringia From: Encyclopedia of Quaternary Science, 2, (2013) 191-201. doi:10.1016/B978-0-444-53643-3.00116-3. pp +191
[3] John F. Hoffecker, Scott A. Elias and Dennis H. O'Rourke, (2014). Out of Beringia?. Science, vol. 343, no. 6174, pp. 979-980; doi: 10.1126/science.1250768

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall © 

The oldest sequenced Human genome

A Russian artist, Nikolay Peistov uncovered the remains of a human being (H. sapiens) in Western Siberia in 2008 while he was looking for mammoth tusks as a source of ivory for his work (he carves ivory).

The find took place along the shores of Irtysh River at Ust-Ishim. Among his hoard of ivory was a bonew which turned out to be a human tighbone 45,000 years old.

The bone's genome was sequenced by a team led by Svante Pääbo, of the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany, and their findings are interesting:

Oldest human genome sequenced

This is the oldest human genome that has been sequenced (45,000 years old), and the team found that this person: had more Neanderthal DNA than modern Asians or Europeans have, and that this Neander genetic material was unevenly distributed, being found in longer sequences than those found in modern humans.

This "integrity" of the archaic sequences means that Neander - Human admixture had taken place quite recently. This is because each passing generation breaks up the DNA segments due to crossover and exchange of DNA between parents, so a more intact sequence means a more recent introgression.

The information is scarce because these findings have not been published yet in a scientific journal, they were only mentioned in an article in Science magazine [1].

Other human remains close by

Interestingly the "Denisovans" are not mentioned as part of this man's genome.

Denisova Cave is also located in Southern Siberia and it is a site that displays cultural sequences dating from 282.0 ± 56.0 Kya to roughly 9.8 Kya, including not only modern humans but also Neanderthals and the mysterious Denisovans. Denisovan ancestry has been found in Papuans suggesting human - Denisovan admixture, but Pääbo does not mention them in relation to the Ust-Ishim genome.

We should point out that there is evidence of Mid Paleolithic occupations within the 45 kya period, in the region surrounding Denisova: [2]

• Kara-Bom. Located about 60 km (38 mi.) south of Denisova Cave. With an earliest occupation date of 43,300 and 44,000 BP.
• Ust-Karakol 1, right beside Denisova Cave, to the south has Mousterian layesrs with dates ranging from 50,000 +- 12,000 to 35,100 BP.
• Okladnikov, about 30 km north of Denisova Cave, along the same Amui River. has dates of 43,000 to 28,500 BP.

Any of these people could have been contemporaries of the Ust-Ishim man.

Sites in Siberia mentioned in the text. Copyright © 20143 by Austin Whittall

Long before him, Hominids have inhabited these parts of Siberia for several hundreds of thousands of years [2]:

"According to Arkhipov (1999), the earliest human occupation of eastern and northeastern Siberia (for example, Berezhekovo site in the Yenisei River basin) could have occurred during the Tobolian Interglacial [...] about 380,000 - 260,000 years ago, though only a few sites may correspond to this time interval (such as Berezhekovo and Diring Yuriakh). [...]
At Berezhekovo, thermoluminescence (TL) dates of 130,000+ -10,000 years above the cultural layer, and 540,000 + -12,000 years below the cultural layer were obtained (Arkhipov 1999) [...] At Diring Yuriakh, an open air site in central Yakutia, the 370,000 - 270,000 year determinations by TL dating (Waters et al. 1999; Carlson 2001)..." [2]

Mal'ta boy

Younger than those ancient remains, and even younger than the Ust-Ishim remains are those from Mal'ta:

• The specimen (MA-1) from Mal'ta in South-Central Siberia, is a modern H. Sapiens 24,000 years old.
• American Indians share between 14 and 38% of their autosomal ancestry with him.
• Genetically, MA-1 is closer to contemporary Native Americans than to Northeast Asians.
• However he is different from Amerindians: he lacks shoveled incisors and his nuclear and mtDNA haplogroups (hg) are different from those found in America:
  
  • His Y chromosome is hg R; common in India and Western Eurasia yet much younger than the hg Q found in very high frequencies in the Americas (and a small region in Northern Central Siberia.
  • His mtDNA is hg U, which is not found in America or East and South Asia and is very frequent in Western Eurasia, India and North Africa.

Considering that 20,000 years separate Mal'ta and Ust-Ishim yet Mal'ta appears to be closer to Europeans than to East Asians, it will be interesting to find out the Y and mtDNA hg of Ust-Ishim. Will they be ancestral to Mal'ta's? Since American Natives have a higher proportion of Neanderthal genes than other groups from this region, could they be closer to the Ust-Ishim people than Eastern Asians? Did the Ust-Ishim move on, into America 45 ky ago?

We will have to be patient and wait for the final paper.

Sources

[1] Ann Gibbons, (2014), News & Analysis. Human Evolution. Oldest Homo sapiens Genome Pinpoints Neandertal Input. Science 28 March 2014: Vol. 343 no. 6178 p. 1417. DOI: 10.1126/science.343.6178.1417
[2] Anatoly P. Derevianko, Alexander V. Postnov, Eugeny P. Rybin, Yaroslav V. Kuzmin and Susan G. Keates, (2005). The Pleistocene peopling of Siberia: A review of environmental and behavioural aspectsIndo-Pacific Prehistory Association Bulletin 25, 2005 (Taipei Papers, Vol 3). pp. +57

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall © 

Hookworms and the peopling of America -more data

Today's post continues my previous post on hookworms and the peopling of America.

One of the issues was if it was possible for these parasites to make it into America across the cold Beringian region during the lifespan of an adult hookworm since it seemed improbable that they could fulfill their early life phase in the area's frozen soil. An option could be a warmer period which allowed the eggs to hatch and larvae appear in time to re-infest the migrating humans but, which was not warm enought to melt the ice caps and flood the Beringian landbridge. It seems that this is could be the case:

Warm but not too warm

A paper by Rabassa and Ponce [1] looks into the very cold Heinrich (H) periods and warmer Dansgaard-Oeschger (D-O) climatic events that took place during MIS 3 (Marine Isotope Stage 3), a "relatively warm climatic period" between 60-50 and 30 ky ago (cal. ka BP).

During this period the "mean annual temperatures were ca. 5 - 8°C higher than those active at the Last Glacial Maximum (LGM)". The LGM took place some 25 kya. and marks the point of maximum ice coverage (and also the lowest temperatures).

What is surprising is that even though the climate was much warmer, the ice sheets did not melt completely, so sea level remained "low enough to allow the persistence of the Beringia land bridge between Siberia and North America, without any interruptions throughout the entire MIS 3.". [1]

These peculiar conditions lead the authors to conclude that:

"... thus both the hinterland path from Beringia southwards and the coastal route would have been open and enjoying moderate climate ecosystems, and thus available for humans. In this case, it is now possible to suggest possible moments for human penetration in North America, perhaps between ca. 50 to 28 cal. ka B.P...[1]

In other words we have a period during which the Beringian land bridge was high and dry and warm enough to allow humans to cross it 60 - 30 kya. Which also opens the possibility for a Neanderthal migration into America or a very early migration of modern humans. Furthermore, since the mechanisms that originted the H and D-O events are not unique, it also may mean that similar conditions could have existed during other even earlier interstadial stages, which could have been used by Neanderthals or even H. erectus to cross into America under warmer conditions.

Could these warmer temperatures have allowed the survival of hookworm eggs in the soil? Maybe. This would do away with the need for hypothetical transoceanic migrations that purportedly brought the worm to America before the oldest dated worm sample from this continent (7.2 kya).

On Hookworms and their diversity

A recent paper by Hasegawa H, Modry D, Kitagawa M, Shutt KA, Todd A, et al. (2014) [2] looked into different genetic markers of hookworms in Africa, both among humans and Great Apes and came up with some interesting information but fail to recognize it, because of the "old" references they used:

Below they mention the "ITS" or Internal transcribed spacer of nuclear ribosomal DNA:

"The ITS sequences of type I ( = N. americanus) were much closer to those reported in samples from human in Guatemala than those in samples from humans in China or Malaysia." [2]

This is very interesting: How come American and African samples are closer to each other than to the Asian ones which are located midway between them?

The authors don't find this relevant and play it down stating that:

"This close relationship is not unexpected, as N. americanus in the Americas might have been introduced from Africa by human migration in the early modern ages." [14]
[...]
[14] Looss A (1911) The anatomy and life history of Agchylostoma duodenale Dub. A monograph. Part II: The development in the free state. Rec Sch Med 4: 159–613." [2]

But, as I reported in my previous post, N. americanus was found in +7,200 year old fossil human excrement discovered in Brazil, long before any "early modern ages" exchange between Africa and America (i.e. slave trade). The authors did not consider this paper and quote a rather old one from 1911!

Of course, it is quite probable that the Guatemalan sample came from an African hookworm, that colonized the New World after the XV century, spreading across the continent and displacing the ancestral forms such as the Brazilian one.

The paper also found "the first molecular evidence that N. americanus parasitizes wild western lowland gorillas, but at a much lower prevalence than we reported in humans." [2]. This is a clear indication of an African origin of this variety of hookworm. We would not expect a human parasite to plague gorillas, rather, it should be the opposite.

The paper also reports that "Although humans are often regarded as the only natural host of N. americanus, other primates, including gorillas, chimpanzees, several Old and New World monkeys and other mammals, such as pangolins, have also been reported as hosts of this nematode" [2]. If this is the case, then the hookworm could have entered America via a small mammal millions of years ago during a very warm period. This would make any conjectures about human migrations pointless.

Nevertheless, the similarity between American and African lineages means that the split is much more recent.

Closing Comments

I believe that more data is needed, a comparison of the genome of Asian, African, American (contemporary and archaic) hookworms in humans and other mammals to settle the issue.

But even if the hookworms don't provide evidence for an early peopling of America, the fact that the Beringian land bridge may have existed during older periods and be warmer than the latest bridge (the one H. sapiens is supposed to have used to enter America), is encouraging and may ultimately support the theory of an initial peoping by Neanderthals (or even H. erectus).

Sources

[1] Raassa J., and Ponce, J. (2013)., The Heinrich and Dansgaard-Oeschger Climatic events during Marine Isotopic Stage 3: Searching for Appropriate Times for Human colonization of the Americas. Quaternary International, 2013 vol. 299 p. 94.
[2] Hasegawa H, Modrý D, Kitagawa M, Shutt KA, Todd A, et al. (2014). Humans and Great Apes Cohabiting the Forest Ecosystem in Central African Republic Harbour the Same Hookworms. PLoS Negl Trop Dis 8(3): e2715. doi:10.1371/journal.pntd.0002715

---

Patagonian Monsters - Cryptozoology, Myths & legends in Patagonia Copyright 2009-2014 by Austin Whittall ©